콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

EHU071471

Sigma-Aldrich

MISSION® esiRNA

targeting human AL513122.2, GSN, AL513122.1

로그인조직 및 계약 가격 보기
모든 사진(1)

About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

100

제품 라인

MISSION®

형태

lyophilized powder

esiRNA cDNA 표적 서열

CCCACCAACCTTTATGGAGACTTCTTCACGGGCGACGCCTACGTCATCCTGAAGACAGTGCAGCTGAGGAACGGAAATCTGCAGTATGACCTCCACTACTGGCTGGGCAATGAGTGCAGCCAGGATGAGAGCGGGGCGGCCGCCATCTTTACCGTGCAGCTGGATGACTACCTGAACGGCCGGGCCGTGCAGCACCGTGAGGTCCAGGGCTTCGAGTCGGCCACCTTCCTAGGCTACTTCAAGTCTGGCCTGAAGTACAAGAAAGGAGGTGTGGCATCAGGATTCAAGCACGTGGTACCCAACGAGGTGGTGGTGCAGAGACTCTTCCAGGTCAAAGGGCGGCGTGTGGTCCGTGCCACCGAGGTACCTGTGTCCTGGGAGAGCTTCAACAATGGCGACTGCTTCATCCTGGACCTGGGCAACAACATCCACCAGTGGTGTGGTTCCAACAG

Ensembl | 인체 수납 번호

ENSG00000148180

NCBI 수납 번호

NM_198252

배송 상태

ambient

저장 온도

−20°C

유전자 정보

human ... AL513122.2(2934) , GSN(2934)

관련 카테고리

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable

시험 성적서(COA)

제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Meshach Asare-Werehene et al.
Oncogene, 39(7), 1600-1616 (2019-11-09)
Ovarian cancer (OVCA) is the most lethal gynecological cancer, due predominantly to late presentation, high recurrence rate and common chemoresistance development. The expression of the actin-associated protein cytosolic gelsolin (GSN) regulates the gynecological cancer cell fate resulting in dysregulation in
Meshach Asare-Werehene et al.
Cancer research, 80(18), 3959-3971 (2020-07-10)
Although initial treatment of ovarian cancer is successful, tumors typically relapse and become resistant to treatment. Because of poor infiltration of effector T cells, patients are mostly unresponsive to immunotherapy. Plasma gelsolin (pGSN) is transported by exosomes (small extracellular vesicle
Zhi-Yuan Chen et al.
Journal of biomedical science, 22, 90-90 (2015-10-21)
Increasing evidence suggests that transforming growth factor-beta 1 (TGF-β1) triggers epithelial to mesenchymal transition (EMT) and facilitates breast cancer stem cell differentiation. Gelsolin (GSN) is a ubiquitous actin filament-severing protein. However, the relationship between the expression level of GSN and
Dylan Z Kelley et al.
Translational research : the journal of laboratory and clinical medicine, 202, 109-119 (2018-08-18)
We have recently performed the characterization of alternative splicing events (ASEs) in head and neck squamous cell carcinoma, which allows dysregulation of protein expression common for cancer cells. Such analysis demonstrated a high ASE prevalence among tumor samples, including tumor-specific

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.