설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
GCTTCCTGTAAATGGCAAGGCTCTCTGGATGCTGTAATGCCCCATCTGATGCATCAGCATAAGTCCATTACAACCCTACAGGGAGAGGATATAGTTTTTCTTGCTACAGACATTAATCTTCCTGGTGCTGTTGACTGGGTGATGATGCAGTCCTGTTTTGGCTTTCACTTCATGTTAGTCTTAGAGAAACAGGAAAAATACGATGGTCACCAGCAGTTCTTCGCAATCGTACAGCTGATAGGAACACGCAAGCAAGCTGAAAATTTTGCTTACCGACTTGAGCTAAATGGTCATAGGCGACGATTGACTTGGGAAGCGACTCCTCGATCTATTCATGAAGGAATTGCAACAGCCATTATGAATAGCGACTGTCTAGTCTTTGACACCAGCATTGCACAGCTTTTTGCAGA
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... SIAH1(6477) , SIAH1(6477)
일반 설명
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
Alessandro Rolfo et al.
PloS one, 5(10), e13288-e13288 (2010-10-23)
The pathogenesis of preeclampsia, a serious pregnancy disorder, is still elusive and its treatment empirical. Hypoxia Inducible Factor-1 (HIF-1) is crucial for placental development and early detection of aberrant regulatory mechanisms of HIF-1 could impact on the diagnosis and management
Yang He et al.
Molecular cancer research : MCR, 17(5), 1129-1141 (2019-02-24)
Patients suffering from glioblastoma have a dismal prognosis, indicating the need for new therapeutic targets. Here we provide evidence that the DNA damage kinase HIPK2 and its negative regulatory E3-ubiquitin ligase SIAH1 are critical factors controlling temozolomide-induced cell death. We
Sujeong Yeom et al.
The Journal of general virology, 98(7), 1774-1784 (2017-07-18)
The seven in absentia homologue 1 (Siah-1) protein is an E3 ubiquitin ligase that induces ubiquitin-dependent proteasomal degradation of HBx, the principal regulatory protein of hepatitis B virus (HBV); however, its role in HBV propagation remains unknown. Here, we found
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.