설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
형태
lyophilized powder
esiRNA cDNA 표적 서열
CGGTTGTTTGTTGGGAATCTACCTGCTGATATCACGGAGGATGAATTCAAAAGACTATTTGCTAAATATGGAGAACCAGGAGAAGTTTTTATCAACAAAGGCAAAGGATTCGGATTTATTAAGCTTGAATCTAGAGCTTTGGCTGAAATTGCCAAAGCCGAACTGGATGATACACCCATGAGAGGTAGACAGCTTCGAGTTCGCTTTGCCACACATGCTGCTGCCCTTTCTGTTCGTAATCTTTCACCTTATGTTTCCAATGAACTGTTGGAAGAAGCCTTTAGCCAATTTGGTCCTATTGAAAGGGCTGTTGTAATAGTGGATGATCGTGGAAGATCTACAGGGAAAGGCATTGTTGAATTTGCTTCTAAGCCAGCAGCAAGAAAGGCATTTGAACGATGCAGTGAAGG
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... SFPQ(6421) , SFPQ(6421)
일반 설명
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
시험 성적서(COA)
제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.
Mirjana Malnar et al.
Journal of cell science, 134(4) (2021-01-27)
The expanded GGGGCC repeat mutation in the C9orf72 gene is the most common genetic cause of the neurodegenerative diseases amyotrophic lateral sclerosis (ALS) and frontotemporal dementia (FTD). The expansion is transcribed to sense and antisense RNA, which form RNA foci
Lotte Victoria Winther Stagsted et al.
eLife, 10 (2021-01-22)
Circular RNAs (circRNAs) represent an abundant and conserved entity of non-coding RNAs; however, the principles of biogenesis are currently not fully understood. Here, we identify two factors, splicing factor proline/glutamine rich (SFPQ) and non-POU domain-containing octamer-binding protein (NONO), to be
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.