콘텐츠로 건너뛰기
Merck
모든 사진(1)

문서

EHU070971

Sigma-Aldrich

MISSION® esiRNA

targeting human CUL1

로그인조직 및 계약 가격 보기


About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

제품 라인

MISSION®

형태

lyophilized powder

esiRNA cDNA 표적 서열

AATGCCCTGGTAATGTCTGCATTCAACAATGACGCTGGCTTTGTGGCTGCTCTTGATAAGGCTTGTGGTCGCTTCATAAACAACAACGCGGTTACCAAGATGGCCCAATCATCCAGTAAATCCCCTGAGTTGCTGGCTCGATACTGTGACTCCTTGTTGAAGAAAAGTTCCAAGAACCCAGAGGAGGCAGAACTAGAAGACACACTCAATCAAGTGATGGTTGTCTTCAAGTACATAGAAGACAAAGACGTATTTCAGAAGTTCTATGCGAAGATGCTCGCCAAGAGGCTCGTCCACCAGAACAGTGCAAGTGACGATGCCGAAGCCAGCATGATCTCCAAGTTAAAGCAAGCTTGCGGGTTCGAGTACACCTCTAAACTTCAGCGCATGTTTCAAGACATTGGCGTGAG

Ensembl | 인체 수납 번호

NCBI 수납 번호

배송 상태

ambient

저장 온도

−20°C

유전자 정보

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable


시험 성적서(COA)

제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Yue-Chao Fan et al.
Medical oncology (Northwood, London, England), 31(10), 227-227 (2014-09-10)
This study was designed to explore the role of Cullin1 (Cul1) in the pathogenesis of human glioma and to investigate the role of Cul1 in the growth, migration and invasion of glioma cells. Expression of Cul1 in 191 glioma tissues
Yan Zhou et al.
BMC cancer, 16(1), 818-818 (2016-10-23)
Triple-negative breast cancer (TNBC) has aggressive progression with poor prognosis and ineffective treatments. Selumetinib is an allosteric, ATP-noncompetitive inhibitor of MEK1/2, which has benn known as effective antineoplastic drugs for several malignant tumors. We hypothesized that Selumetinib might be potential
Ye-Fei Huang et al.
Cell death & disease, 10(1), 2-2 (2018-12-24)
CUL1 is an essential component of SCF (SKP1-CUL1-F-box protein) E3 ubiquitin ligase complex. Our previous study has showed that CUL1 is positively associated with poor overall and disease-specific survival of breast cancer patients. Here, we further explored its roles in

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.