콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

EHU067451

Sigma-Aldrich

MISSION® esiRNA

targeting human MEN1

로그인조직 및 계약 가격 보기


About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

제품 라인

MISSION®

양식

lyophilized powder

esiRNA cDNA 표적 서열

ACTCTGAGCCCATGTTCTGCCCCCAGCCCAAAGGGGACAGGCCTCACCTCTACCCAAACCCTAGGTTCCCGGTCCCGAGTACAGTCTGTATCAAACCCACGATTTTCTCCAGCTCAGAACCCAGGGCTCTGCCCCAGTCGTTAGAATATAGGTCTCTTCTCCCAGAATCCCAGCCGGCCAATGGAAACCTCACGCTGGGTCCTAATTACCAGTCTTTAAAGGCCCAGCCCCTAGAAACCCAAGCTCCTCCTCGGAACCGCTCACCTAGAGCCAGACCAACGTTACTCAGGGCTCCTCCCAGCTTGTAGGAGCTGAGGTTTCACCCTTAACCCAAGGAGCACAGGTCCCACCTCCAGCCCGGGAGCCTAGGACCACTCAGCCCCTAGGAGTATATTTCCGCACTTCAGAATTCC

Ensembl | 인체 수납 번호

NCBI 수납 번호

배송 상태

ambient

저장 온도

−20°C

유전자 정보

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable


가장 최신 버전 중 하나를 선택하세요:

시험 성적서(COA)

Lot/Batch Number

적합한 버전을 찾을 수 없으신가요?

특정 버전이 필요한 경우 로트 번호나 배치 번호로 특정 인증서를 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Giulia Stefania Tavanti et al.
International journal of molecular sciences, 22(4) (2021-03-07)
The Hippo pathway is involved in human tumorigenesis and tissue repair. Here, we investigated the Hippo coactivator Yes-associated protein 1 (YAP1) and the kinase large tumor suppressor 1/2 (LATS1/2) in tumors of the parathyroid glands, which are almost invariably associated
Annamaria Morotti et al.
Journal of bone and mineral research : the official journal of the American Society for Bone and Mineral Research, 35(12), 2423-2431 (2020-08-12)
A role for long non-coding RNAs (lncRNAs) in endocrine cancer pathogenesis is emerging. However, knowledge regarding their expression pattern, correlation with known genetic defects, and clinical implications in parathyroid tumors is still unclear. Here, we profiled 90 known lncRNAs in
Laurent Ehrlich et al.
The American journal of pathology, 187(3), 570-580 (2017-01-15)
Menin (MEN1) is a tumor-suppressor protein in neuroendocrine tissue. Therefore, we tested the novel hypothesis that menin regulates cholangiocarcinoma proliferation. Menin and miR-24 expression levels were measured in the following intrahepatic and extrahepatic cholangiocarcinoma (CCA) cell lines, Mz-ChA-1, TFK-1, SG231

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.