콘텐츠로 건너뛰기
Merck
모든 사진(1)

문서

EHU067421

Sigma-Aldrich

MISSION® esiRNA

targeting human LRP1

로그인조직 및 계약 가격 보기
모든 사진(1)

About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

제품 라인

MISSION®

형태

lyophilized powder

esiRNA cDNA 표적 서열

TGCTACTGCAACAGCAGCTTTCAGCTTCAGGCAGATGGCAAGACCTGCAAAGATTTTGATGAGTGCTCAGTGTACGGCACCTGCAGCCAGCTATGCACCAACACAGACGGCTCCTTCATATGTGGCTGTGTTGAAGGATACCTCCTGCAGCCGGATAACCGCTCCTGCAAGGCCAAGAACGAGCCAGTAGACCGGCCCCCTGTGCTGTTGATAGCCAACTCCCAGAACATCTTGGCCACGTACCTGAGTGGGGCCCAGGTGTCTACCATCACACCTACGAGCACGCGGCAGACCACAGCCATGGACTTCAGCTATGCCAACGAGACCGTATGCTGGGTGCATGTTGGGGACAGTGCTGCTCAGACGCAGCTCAAGTGTGCCCGCATGCCTGGCCTAAAGGGCTTCGTGGATGAG

Ensembl | 인체 수납 번호

ENSG00000123384

NCBI 수납 번호

NM_002332

배송 상태

ambient

저장 온도

−20°C

유전자 정보

human ... LRP1(4035) , LRP1(4035)

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable

시험 성적서(COA)

제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Jianhua Peng et al.
Redox biology, 21, 101121-101121 (2019-02-01)
White matter injury (WMI) is associated with motor deficits and cognitive dysfunctions in subarachnoid hemorrhage (SAH) patients. Therapeutic strategy targeting WMI would likely improve the neurological outcomes after SAH. Low-density lipoprotein receptor-related protein-1 (LRP1), a scavenger receptor of apolipoprotein E
Ling Lin et al.
Oncotarget, 8(50), 88094-88103 (2017-11-21)
Macrophage accumulation is one of the hallmarks of progressive kidney disease. In response to injury, macrophages undergo a phenotypic polarization to become two functionally distinct subsets: M1 and M2 macrophages. Macrophage polarization is a dynamic process, and recent work indicates
Paola Merino et al.
The Journal of biological chemistry, 292(7), 2741-2753 (2016-12-18)
Axonal injury is a common cause of neurological dysfunction. Unfortunately, in contrast to axons from the peripheral nervous system, the limited capacity of regeneration of central nervous system (CNS) axons is a major obstacle for functional recovery in patients suffering
Tomoya Kitakaze et al.
Biochimica et biophysica acta. Molecular cell research, 1867(2), 118563-118563 (2019-11-02)
Skeletal muscle secretes biologically active proteins that contribute to muscle hypertrophy in response to either exercise or dietary intake. The identification of skeletal muscle-secreted proteins that induces hypertrophy can provide critical information regarding skeletal muscle health. Dietary provitamin A, β-carotene
Aline Appert-Collin et al.
Cell adhesion & migration, 11(4), 316-326 (2016-07-28)
The low-density lipoprotein receptor-related protein-1 (LRP-1) is a member of Low Density Lipoprotein Receptor (LDLR) family, which is ubiquitously expressed and which is described as a multifunctional endocytic receptor which mediates the clearance of various extracellular matrix molecules including serine
모든 관련된 서류 보기

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.