콘텐츠로 건너뛰기
Merck
모든 사진(1)

문서

EHU067331

Sigma-Aldrich

MISSION® esiRNA

targeting human TRIM28

로그인조직 및 계약 가격 보기
모든 사진(1)

About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

100

제품 라인

MISSION®

형태

lyophilized powder

esiRNA cDNA 표적 서열

CACAAGGACCACCAGTACCAGTTCTTAGAGGATGCAGTGAGGAACCAGCGCAAGCTCCTGGCCTCACTGGTGAAGCGCCTTGGGGACAAACATGCAACATTGCAGAAGAGCACCAAGGAGGTTCGCAGCTCAATCCGCCAGGTGTCTGACGTACAGAAGCGTGTGCAAGTGGATGTCAAGATGGCCATCCTGCAGATCATGAAGGAGCTGAATAAGCGGGGCCGTGTGCTGGTCAATGATGCCCAGAAGGTGACTGAGGGGCAGCAGGAGCGCCTGGAGCGGCAGCACTGGACCATGACCAAGATCCAGAAGCACCAGGAGCACATTCTGCGCTTTGCCTCTTGGGCTCTGGAGAGTGACAACAACACAGCCCTTTTGCTTTCTAAGAAGTTGATCTACTTCCAGCTGCACCG

Ensembl | 인체 수납 번호

ENSG00000130726

NCBI 수납 번호

NM_005762

배송 상태

ambient

저장 온도

−20°C

유전자 정보

human ... TRIM28(10155) , TRIM28(10155)

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable

시험 성적서(COA)

제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Min Li et al.
Proceedings of the National Academy of Sciences of the United States of America, 117(38), 23588-23596 (2020-09-10)
In human cells, the DNA replication factor proliferating cell nuclear antigen (PCNA) can be conjugated to either the small ubiquitinlike modifier SUMO1 or SUMO2, but only SUMO2-conjugated PCNA is induced by transcription to facilitate resolution of transcription-replication conflict (TRC). To
Hongtao Liu et al.
Chemico-biological interactions, 311, 108772-108772 (2019-07-28)
Atherosclerosis is a common type of cardiovascular disease (CVD), remaining one of the leading causes of global death. Tripartite motif-containing 28 (TRIM28) is a member of TRIM family that has been found to be involved in atherosclerosis. However, the role
Xiao-Hua Zhang et al.
Molecular medicine reports, 23(3) (2021-01-06)
Myocardial ischemia/reperfusion (MIR) injury, which occurs following acute myocardial infarction, can cause secondary damage to the heart. Tripartite interaction motif (TRIM) proteins, a class of E3 ubiquitin ligases, have been recognized as critical regulators in MIR injury. Zenglv Fumai Granule (ZFG) is a
Hitoshi Ohtani et al.
Genome research, 28(8), 1147-1157 (2018-07-05)
We provide a comprehensive genomic and epigenomic map of the more than 500,000 endogenous retroviruses (ERVs) and fragments that populate the intergenic regions of the human genome. The repressive epigenetic marks associated with the ERVs, particularly long terminal repeats (LTRs)
Eun Kyoung Do et al.
Cell death and differentiation, 28(2), 685-699 (2020-09-09)
Oct4 plays a crucial role in the regulation of self-renewal of embryonic stem cells (ESCs) and reprogramming of somatic cells to induced pluripotent stem cells. However, the molecular mechanisms underlying posttranslational regulation and protein stability of Oct4 remain unclear. Using
모든 관련된 서류 보기

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.