콘텐츠로 건너뛰기
Merck
모든 사진(1)

Key Documents

EHU065101

Sigma-Aldrich

MISSION® esiRNA

targeting human TRO

로그인조직 및 계약 가격 보기


About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

제품 라인

MISSION®

형태

lyophilized powder

esiRNA cDNA 표적 서열

ACAAAGATCCCCATCAAACGCTCAGACATGCTGAGGGATGTCATCCAAGAATATGATGAATATTTCCCAGAAATCATTGAACGAGCAAGCTACACTCTGGAGAAGATGTTTCGAGTCAATCTGAAAGAAATTGATAAGCAAAGTAGCTTGTATATTCTCATCAGCACTCAGGAATCCTCTGCAGGCATACTGGGAACGACCAAGGACACACCCAAGCTGGGTCTCCTCATGGTGATTCTGAGTGTCATTTTTATGAATGGCAACAAGGCCAGTGAGGCTGTCATCTGGGAGGTGCTGCGCAAGTTGGGGCTGCGCCCTGGGGTGAGGCATTCACTCTTTGGGGAAGTGAGGAAGCTCATCACAGACGAGTTTGTGAAGCAGAAGTACCTGGAGTACAAGAGGGTCCCTAACAGCA

Ensembl | 인체 수납 번호

NCBI 수납 번호

배송 상태

ambient

저장 온도

−20°C

유전자 정보

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable


시험 성적서(COA)

제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Guoshuai Cao et al.
Cancer communications (London, England), 41(1), 51-61 (2021-07-09)
The interaction between activating receptor NKp30 and its major tumor ligand B7-H6 is important for NK cell-mediated tumor rejection. However, the regulation of B7-H6 by tumor therapeutics remains largely unknown. In this study, we investigated the regulation of B7-H6 by
Hongyong Fu et al.
Molecular therapy. Nucleic acids, 12, 769-786 (2018-08-25)
Spermatogonial stem cells (SSCs) have significant applications in reproductive and regenerative medicine. However, nothing is known about genes in mediating human SSCs. Here we have explored for the first time the function and mechanism of P21-activated kinase 1 (PAK1) in
Min Young Ahn et al.
Journal of vascular research, 55(2), 75-86 (2018-02-07)
Thrombospondin-1 (TSP-1) is implicated in vascular diseases associated with oxidative stress, such as abdominal aortic aneurysms, ischemia-reperfusion injury, and atherosclerosis. However, the regulatory mechanisms underlying TSP-1 expression are not fully elucidated. In this study, we found that peroxisome proliferator-activated receptor

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.