설명
Powered by Eupheria Biotech
제품 라인
MISSION®
형태
lyophilized powder
esiRNA cDNA 표적 서열
AGTACCAGCCTCAGCCTTGAGAGGCCTTGAGAGGCCCTGGGGTTCTCCCCCTTTCTCTCCAGCCTGACTTGGGGAGATGGAGTTCTTGTGCCATAGTCACATGGCCTATGCACATATGGACTCTGCACATGAATCCCACCCACATGTGACACATATGCACCTTGTGTCTGTACACGTGTCCTGTAGTTGCGTGGACTCTGCACATGTCTTGTACATGTGTAGCCTGTGCATGTATGTCTTGGACACTGTACAAGGTACCCCTTTCTGGCTCTCCCATTTCCTGAGACCACAGAGAGAGGGGAGAAGCCTGGGATTGACAGAAGCTTCTGCCCACCTACTTTTCTTTCCTCAGATCATCCAGAAGTTCCTCAAGGGCCAGGACTTTATCTAATACCTCTGTGTGCTCCTCCTTGGT
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
일반 설명
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
시험 성적서(COA)
제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.
Jeffrey J Kim et al.
Stem cells (Dayton, Ohio), 32(6), 1468-1479 (2014-02-13)
Molecular markers defining self-renewing pluripotent embryonic stem cells (ESCs) have been identified by relative comparisons between undifferentiated and differentiated cells. Most of analysis has been done under a specific differentiation condition that may present significantly different molecular changes over others.
S-Y Nam et al.
Clinical and experimental allergy : journal of the British Society for Allergy and Clinical Immunology, 48(7), 875-889 (2018-05-13)
Thymic stromal lymphopoietin (TSLP) is a regulator of mast cell-mediated allergic inflammatory reactions, but the manner in which TSLP contributes to allergic rhinitis (AR) remains unclear. Here, we sought to determine that TSLP plays a crucial role in AR by
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.