설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
GCCAGACCTGGAAGAACAAAGAGCATCATCTCTCTGACAGAGAGTTTGTGTTCAAAGAACCTCAGCAGGTAGTACGTAGAGCTCCTGAGCCACGAGTGATTGACAGAGAGGGTGTGTATGAAATCAGCCTGTCACCCACAGGTGTATCTAGGGTCTGTTTGTATCCTGGCTTTGTTGACGTGAAAGAAGCTGACTGGATATTGGAACAGCTTTGTCAAGATGTTCCCTGGAAACAGAGGACTGGCATCAGAGAGGATATAACTTATCAGCAACCAAGACTTACAGCATGGTATGGAGAACTTCCTTACACTTATTCAAGAATCACTATGGAACCAAATCCTCACTGGCACCCTGTGCTGCGCACACTAAAGAACCGCATTGAAGAGAACACTGGCCACACCTTCAACTCCTTACTCTGCAATCTTTATCGCAATGAGAAGGACAGCGTGGACTGGCACAGTGATGATG
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... ALKBH3(221120) , ALKBH3(221120)
일반 설명
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
가장 최신 버전 중 하나를 선택하세요:
Yuko Ueda et al.
Scientific reports, 7, 42271-42271 (2017-02-17)
The mammalian AlkB homolog (ALKBH) family of proteins possess a 2-oxoglutarate- and Fe(II)-dependent oxygenase domain. A similar domain in the Escherichia coli AlkB protein catalyzes the oxidative demethylation of 1-methyladenine (1-meA) and 3-methylcytosine (3-meC) in both DNA and RNA. AlkB
Thai Q Tran et al.
PLoS biology, 15(11), e2002810-e2002810 (2017-11-07)
Driven by oncogenic signaling, glutamine addiction exhibited by cancer cells often leads to severe glutamine depletion in solid tumors. Despite this nutritional environment that tumor cells often experience, the effect of glutamine deficiency on cellular responses to DNA damage and
Kiyohiko Hotta et al.
Oncology reports, 34(2), 648-654 (2015-06-03)
Prostate cancer antigen-1 (PCA-1)/ALKBH3 has been recently identified in human prostate cancer and its expression is correlated with disease progression and prognosis. However, the precise role and function of PCA-1/ALKBH3 in human malignancies are largely unknown. In the present study
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.