설명
Powered by Eupheria Biotech
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
TCATCAATCCACAGCTGCTCAGCATCCTGATCAGGTTTATCTCCAACCCCATGGCCCCCTCCTGGTGGGGCTTCCTGGTGGCTGGGCTGATGTTCCTGTGCTCCATGATGCAGTCGCTGATCTTACAACACTATTACCACTACATCTTTGTGACTGGGGTGAAGTTTCGTACTGGGATCATGGGTGTCATCTACAGGAAGGCTCTGGTTATCACCAACTCAGTCAAACGTGCGTCCACTGTGGGGGAAATTGTCAACCTCATGTCAGTGGATGCCCAGCGCTTCATGGACCTTGCCCCCTTCCTCAATCTGCTGTGGTCAGCACCCCTGCAGATCATCCTGGCGATCTACTTCCTCTGGCAGAACCTAGGTCCCTCTGTCCTGGCTGGAGTCGCTTTCATGGTCTTGCTGATTCCA
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... ABCC3(8714) , ABCC3(8714)
관련 카테고리
일반 설명
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
가장 최신 버전 중 하나를 선택하세요:
Bernd B Zeisig et al.
Science translational medicine, 13(582) (2021-02-26)
Chemoresistance remains the major challenge for successful treatment of acute myeloid leukemia (AML). Although recent mouse studies suggest that treatment response of genetically and immunophenotypically indistinguishable AML can be influenced by their different cells of origin, corresponding evidence in human
Yu-Qin Pan et al.
Biopharmaceutics & drug disposition, 36(4), 232-244 (2015-01-20)
Previous work has indicated that there is increased protein expression of multidrug resistance-associated protein 3 (MRP3) in the liver samples of patients treated with omeprazole compared with those who were not. However, evidence is still lacking to show the mechanisms
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.