추천 제품
설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
AATGGCAGCATTTGTCTTGATATTCTACGATCACAGTGGTCTCCAGCACTAACTATTTCAAAAGTACTCTTGTCCATCTGTTCTCTGTTGTGTGATCCCAATCCAGATGATCCTTTAGTGCCTGAGATTGCTCGGATCTACAAAACAGATAGAGAAAAGTACAACAGAATAGCTCGGGAATGGACTCAGAAGTATGCGATGTAATTAAAGAAATTATTGGATAACCTCTACAAATAAAGATAGGGGAACTCTGAAAGAGAAAGTCCTTTTGATTTCCATTTGACTGCTTTCTATGAGCCCACGCCTCATCTTCCCCTGTGCACATGTTTACCTGATACAGCAGTGCTGCGTGTTGTACATACTTGGAACAACAAACTAGAAATACTGTACTTCTGTACCAACATTGCCTCCTAGCA
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... UBE2D2(7322) , UBE2D2(7322)
일반 설명
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
가장 최신 버전 중 하나를 선택하세요:
Aitor Garzia et al.
Nature communications, 8, 16056-16056 (2017-07-08)
Cryptic polyadenylation within coding sequences (CDS) triggers ribosome-associated quality control (RQC), followed by degradation of the aberrant mRNA and polypeptide, ribosome disassembly and recycling. Although ribosomal subunit dissociation and nascent peptide degradation are well-understood, the molecular sensors of aberrant mRNAs
Qingshui Wang et al.
Biomolecules, 9(4) (2019-04-20)
Death Associated Protein Kinase 1 (DAPK1) is an important signaling kinase mediating the biological effect of multiple natural biomolecules such as IFN-γ, TNF-α, curcumin, etc. DAPK1 is degraded through both ubiquitin-proteasomal and lysosomal degradation pathways. To investigate the crosstalk between
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.