콘텐츠로 건너뛰기
Merck
모든 사진(1)

문서

EHU063351

Sigma-Aldrich

MISSION® esiRNA

targeting human WHSC1

로그인조직 및 계약 가격 보기


About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

제품 라인

MISSION®

형태

lyophilized powder

esiRNA cDNA 표적 서열

CCCACCATACAAGCACATCAAGGTGAATAAGCCTTACGGGAAAGTCCAGATCTACACAGCGGATATTTCAGAAATCCCTAAGTGCAACTGCAAGCCCACAGATGAGAATCCTTGTGGCTTTGATTCGGAGTGTCTGAACAGGATGCTGATGTTTGAGTGCCACCCGCAGGTGTGTCCCGCGGGCGAGTTCTGCCAGAACCAGTGCTTCACCAAGCGCCAGTACCCAGAGACCAAGATCATCAAGACAGATGGCAAAGGGTGGGGCCTGGTCGCCAAGAGGGACATCAGAAAGGGAGAATTTGTTAACGAGTACGTTGGGGAGCTGATCGACGAGGAGGAGTGCATGGCGAGAATCAAGCACGCACACGAGAACGACATCACCCACTTCTACATGCTCACTATAGACAAGGACCGTATAATAGACGCTGGCCCCAAAGGAAACTACTCTCGATTTATGAATCACAGCTGCCAGC

Ensembl | 인체 수납 번호

NCBI 수납 번호

배송 상태

ambient

저장 온도

−20°C

유전자 정보

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable


시험 성적서(COA)

제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Nicole M A White-Al Habeeb et al.
The Prostate, 76(16), 1507-1518 (2016-10-19)
This study explored the biological effects of metformin on prostate cancer (PCa) cells and determined molecular pathways and epigenetic regulators implicated in its mechanism of action. We performed mRNA expression profiling in 22Rv1 cells following 2.5 mM and 5 mM metformin treatment.
Liang-Yan Chen et al.
The Journal of pathology, 248(1), 103-115 (2019-01-23)
Liver metastasis is the main cause of death in patients with colorectal cancer (CRC). Here, we searched for CRC metastasis-associated circular RNA in a mouse model of liver metastasis of CRC by using RNA (transcriptome)-sequencing. We identified a novel and
Jin Woo Park et al.
Scientific reports, 5, 12485-12485 (2015-07-25)
Histone lysine methylation contributes to transcriptional regulation by serving as a platform for the recruitment of various cofactors. Intense studies have been conducted for elucidating the functional meaning of H3K79 methylation, and to date, the only known HMTase responsible for

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.