설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
GTTCGCGATGACTCGGTAGTAGAGAAGTCCCTCAAGTCCTTGAAGGACAAGAACAAGAAGCTGGAGGAAGGCGGCCCGGTGTACAGCCCCCCCGCAGAGGTGGTGGTGAAGAAGTCCCTGGGGCAGCGGGTGCTGGACGAGCTGAAGCACTACTACCATGGCTTCCGCCTGCTATGGATCGACACCAAGATCGCGGCACGCATGCTCTGGCGCATCCTCAACGGCCACAGCCTGACCCGCCGGGAGCGCAGGCAGTTTCTCCGGATCTGCGCTGACCTCTTCCGCCTGGTGCCGTTCCTTGTGTTCGTGGTGGTGCCGTTCATGGAGTTTCTGCTGCCTGTTGCTGTGAAGCTCTTCCCCAACATGTTGCCATCCACATTTGAGACTCAGTCACTCAAGGAGGAGAGGCTGAAGAAGGAGCTTCGGGTCAAGCTGGAGCTGGCCAAGTTCCTCCAGGACACCATCGAGGAGAT
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... LETM1(3954) , LETM1(3954)
일반 설명
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
WGK
WGK 1
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
가장 최신 버전 중 하나를 선택하세요:
Lihua Piao et al.
Cancer management and research, 12, 1649-1660 (2020-03-19)
The leucine zipper-EF-hand containing transmembrane protein 1 (LETM1) is a mitochondrial protein that has been associated with the occurrence and development of malignant tumors. Previous studies have shown that LETM1 expression is increased in several types of human cancer and
Haoyue Li et al.
Experimental and molecular pathology, 112, 104333-104333 (2019-11-11)
Leucine zipper-EF-hand containing transmembrane protein 1 (LETM1) is closely linked to the occurrence and development of many malignant tumors. Many studies have reported that enhanced expression of LETM1 in several types of human cancers was associated with poor clinical outcomes;
Lesley Hart et al.
Disease models & mechanisms, 7(5), 535-545 (2014-03-15)
Wolf-Hirschhorn syndrome (WHS) represents an archetypical example of a contiguous gene deletion disorder - a condition comprising a complex set of developmental phenotypes with a multigenic origin. Epileptic seizures, intellectual disability, growth restriction, motor delay and hypotonia are major co-morbidities
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.