콘텐츠로 건너뛰기
Merck
모든 사진(1)

문서

EHU061741

Sigma-Aldrich

MISSION® esiRNA

targeting human BECN1

로그인조직 및 계약 가격 보기
모든 사진(1)

About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

제품 라인

MISSION®

형태

lyophilized powder

esiRNA cDNA 표적 서열

GGCTGAGAGACTGGATCAGGAGGAAGCTCAGTATCAGAGAGAATACAGTGAATTTAAACGACAGCAGCTGGAGCTGGATGATGAGCTGAAGAGTGTTGAAAACCAGATGCGTTATGCCCAGACGCAGCTGGATAAGCTGAAGAAAACCAACGTCTTTAATGCAACCTTCCACATCTGGCACAGTGGACAGTTTGGCACAATCAATAACTTCAGGCTGGGTCGCCTGCCCAGTGTTCCCGTGGAATGGAATGAGATTAATGCTGCTTGGGGCCAGACTGTGTTGCTGCTCCATGCTCTGGCCAATAAGATGGGTCTGAAATTTCAGAGATACCGACTTGTTCCTTACGGAAACCATTCATATCTGGAGTCTCTGACAGACAAATCTAAGGAGCTGCCGTTATACTGTTCTGGGGGGTTGCGGTTTTTCTGGGACAACAAGTTTGACCATGCAATGGTGGCTTTCCTGGACTGTGTGCAG

Ensembl | 인체 수납 번호

ENSG00000126581

NCBI 수납 번호

NM_003766

배송 상태

ambient

저장 온도

−20°C

유전자 정보

human ... BECN1(8678) , BECN1(8678)

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable

시험 성적서(COA)

제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Haoran Peng et al.
Viruses, 10(5) (2018-05-16)
Autophagy is a common strategy for cell protection; however, some viruses can in turn adopt cellular autophagy to promote viral replication. Zika virus (ZIKV) is the pathogen that causes Zika viral disease, and it is a mosquito-borne virus. However, its
Jingjing Wu et al.
Journal of cellular and molecular medicine, 22(2), 1190-1201 (2017-10-28)
Long-term peritoneal dialysis is accompanied by functional and histopathological alterations in the peritoneal membrane. In the long process of peritoneal dialysis, high-glucose peritoneal dialysis solution (HGPDS) will aggravate the peritoneal fibrosis, leading to decreased effectiveness of peritoneal dialysis and ultrafiltration
Michelle M Coleman et al.
American journal of respiratory cell and molecular biology, 59(5), 548-556 (2018-06-01)
Vitamin A deficiency strongly predicts the risk of developing tuberculosis (TB) in individuals exposed to Mycobacterium tuberculosis (Mtb). The burden of antibiotic-resistant TB is increasing globally; therefore, there is an urgent need to develop host-directed adjunctive therapies to treat TB.
Wenkang Luan et al.
OncoTargets and therapy, 10, 4569-4577 (2017-10-27)
Autophagy is not only a survival response to growth-factor or nutrient deprivation but also an important mechanism for tumor-cell suicide, including melanoma.
Guangmin Xi et al.
Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie, 84, 1610-1616 (2016-11-09)
Multidrug resistance (MDR) is a major obstacle for successful chemotherapy treatment. Searching for effective MDR modulators and combining them with anticancer drug therapies has been a promising strategy against clinical MDR. In our previous study, we have found that DHA-E3
모든 관련된 서류 보기

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.