설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
GCGTCAAGCCTCTGACAACTATTGAATTTGTAAGCTGCTATGCAAATGGGCATTTATATAAACTTGTGATGTTTCTTGTCAGAATTCTGAGTACTCTGTGAAGAACAGAAATGATCATATTCTTATGCATCTATCTGTATGGGTCTGAAGGTGTATATACAAACTGAGATGAGTCCTTATGACTCTTGATAAGCCTGAGTTTAACAACAACAAAAATGCCAAGTTGTCCTGAGCCCTTCTGCGTTGTTATGCCACTTCCCTACTGCTCATATGCACGCTGGCTCCCCTGGGCACGCAAGGATGAGTATGGGCCATGGGCCCCTGTAGAGCTGCTTACCTGGTGATGACCATGCACCTTACAATTTCTGAACAGTTAACCCTATAGAAGCATGCTTTATATGAGTGTCTTCTGGGAAGAGGAACCTTCTTAATCTCTTCTGTGGGATTTTCAAAATGCTAAAGACTCACACTGCAGCAATCATCC
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... TRAF5(7188) , TRAF5(7188)
일반 설명
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
Florian Willecke et al.
Journal of vascular research, 56(6), 308-319 (2019-08-23)
Tumor necrosis factor (TNF) receptor-associated factors (TRAFs) are cytoplasmic adaptor proteins of the TNF/interleukin (IL)-1/Toll-like receptor superfamily. Ligands of this family such as TNFα, CD40L, and IL-1β promote chronic inflammatory processes such as atherosclerosis and restenosis, the latter being a
Jun Shen et al.
International journal of medical sciences, 10(2), 156-163 (2013-01-19)
TRAF3 and TRAF5 share a common ancestral gene, and interact as essential components of signaling pathways in immunity. TRAF3 and TRAF5 are overexpressed in the colon of rat/mouse models with colitis. However, the expressions of TRAF3 and TRAF5 in patients
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.