콘텐츠로 건너뛰기
Merck
모든 사진(1)

문서

EHU060131

Sigma-Aldrich

MISSION® esiRNA

targeting human IL17RB

로그인조직 및 계약 가격 보기


About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

제품 라인

MISSION®

형태

lyophilized powder

esiRNA cDNA 표적 서열

AGGATGCCACTGCTTTCTGTGCAGAACTTCTCCATGTCAAGCAGCAGGTGTCAGCAGGAAAAAGATCACAAGCCTGCCACGATGGCTGCTGCTCCTTGTAGCCCACCCATGAGAAGCAAGAGACCTTAAAGGCTTCCTATCCCACCAATTACAGGGAAAAAACGTGTGATGATCCTGAAGCTTACTATGCAGCCTACAAACAGCCTTAGTAATTAAAACATTTTATACCAATAAAATTTTCAAATATTGCTAACTAATGTAGCATTAACTAACGATTGGAAACTACATTTACAACTTCAAAGCTGTTTTATACATAGAAATCAATTACAGTTTTAATTGAAAACTATAACCATTTTGATAATGCAACAATAAAGCATCTTCAGCCAAACATCTAGTCTTCCATAGACCATGCATTGCAG

Ensembl | 인체 수납 번호

NCBI 수납 번호

배송 상태

ambient

저장 온도

−20°C

유전자 정보

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable


시험 성적서(COA)

제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Yong-Sheng Teng et al.
Cell death & disease, 10(2), 79-79 (2019-01-30)
Interleukin-17 receptor B (IL-17RB), a member of the IL-17 receptor family activated by IL-17B/IL-17E, has been shown to be involved in inflammatory diseases. However, the regulation and function of IL-17RB in Helicobacter pylori (H. pylori) infection, especially in the early-phase
Suxun Pan et al.
Cell biology international, 44(11), 2220-2230 (2020-07-28)
Interleukin-25 (IL-25) has been recognized as a new member of the IL-17 family and implicated in various inflammatory pathology. We aimed to investigate the effects of IL-25 on the expression of matrix metalloproteinase-2 (MMP-2), MMP-8, and MMP-9 in periodontal fibroblast
Lei Ren et al.
Molecular immunology, 90, 126-135 (2017-07-18)
IL-17RB, a member of the IL-17 receptor family that can be activated by IL-17B, has been proved to be involved in inflammatory diseases and cancers. However, the function of IL-17RB in thyroid cancer is still unknown. In this study, IL-17RB

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.