콘텐츠로 건너뛰기
Merck
모든 사진(1)

Key Documents

EHU058791

Sigma-Aldrich

MISSION® esiRNA

targeting human PPARD

로그인조직 및 계약 가격 보기
모든 사진(1)

About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

100

제품 라인

MISSION®

형태

lyophilized powder

esiRNA cDNA 표적 서열

AAGGCCTTCTCCAAGCACATCTACAATGCCTACCTGAAAAACTTCAACATGACCAAAAAGAAGGCCCGCAGCATCCTCACCGGCAAAGCCAGCCACACGGCGCCCTTTGTGATCCACGACATCGAGACATTGTGGCAGGCAGAGAAGGGGCTGGTGTGGAAGCAGTTGGTGAATGGCCTGCCTCCCTACAAGGAGATCAGCGTGCACGTCTTCTACCGCTGCCAGTGCACCACAGTGGAGACCGTGCGGGAGCTCACTGAGTTCGCCAAGAGCATCCCCAGCTTCAGCAGCCTCTTCCTCAACGACCAGGTTACCCTTCTCAAGTATGGCGTGCACGAGGCCATCTTCGCCATGCTGGCCTCTATCGTCAACAAGGACGGGCTGCTGGTAGCCAACGGCAGTGGCTTTGTCACCCGTGAGTTCCTGCGCAGCCTCCGCAAACCCTTCAGTGATATCATTGAGCCTAAGTTTGAATTTGCTGTCAAGTTCAACGC

Ensembl | 인체 수납 번호

ENSG00000112033

NCBI 수납 번호

NM_006238

배송 상태

ambient

저장 온도

−20°C

유전자 정보

human ... PPARD(5467) , PPARD(5467)

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable

시험 성적서(COA)

제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Mark Wei Yi Tan et al.
Cell death and differentiation, 27(9), 2668-2680 (2020-04-22)
The incidence of nonmelanoma skin cancer (NMSC) has been increasing worldwide. Most studies have highlighted the importance of cancer-associated fibroblasts (CAFs) in NMSC progression. However much less is known about the communication between normal fibroblasts and epithelia; disruption of this
H B Shi et al.
Journal of dairy science, 100(1), 797-806 (2016-11-21)
In rodents, peroxisome proliferator-activated receptor delta (PPARD) is associated primarily with catabolism of fatty acids. However, the role of PPARD in regulating lipid metabolism in ruminant mammary gland remains unknown. In the present study, we assessed the mRNA abundance of
Yi Liu et al.
Cancer research, 79(5), 954-969 (2019-01-27)
APC mutations activate aberrant β-catenin signaling to drive initiation of colorectal cancer; however, colorectal cancer progression requires additional molecular mechanisms. PPAR-delta (PPARD), a downstream target of β-catenin, is upregulated in colorectal cancer. However, promotion of intestinal tumorigenesis following deletion of
Trang Thi Thu Nguyen et al.
The Journal of clinical investigation, 130(7), 3699-3716 (2020-04-22)
The Warburg effect is a tumor-related phenomenon that could potentially be targeted therapeutically. Here, we showed that glioblastoma (GBM) cultures and patients' tumors harbored super-enhancers in several genes related to the Warburg effect. By conducting a transcriptome analysis followed by

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.