콘텐츠로 건너뛰기
Merck
모든 사진(1)

문서

EHU058001

Sigma-Aldrich

MISSION® esiRNA

targeting human CLU

로그인조직 및 계약 가격 보기
모든 사진(1)

About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

제품 라인

MISSION®

형태

lyophilized powder

esiRNA cDNA 표적 서열

GACTCTGCTGCTGTTTGTGGGGCTGCTGCTGACCTGGGAGAGTGGGCAGGTCCTGGGGGACCAGACGGTCTCAGACAATGAGCTCCAGGAAATGTCCAATCAGGGAAGTAAGTACGTCAATAAGGAAATTCAAAATGCTGTCAACGGGGTGAAACAGATAAAGACTCTCATAGAAAAAACAAACGAAGAGCGCAAGACACTGCTCAGCAACCTAGAAGAAGCCAAGAAGAAGAAAGAGGATGCCCTAAATGAGACCAGGGAATCAGAGACAAAGCTGAAGGAGCTCCCAGGAGTGTGCAATGAGACCATGATGGCCCTCTGGGAAGAGTGTAAGCCCTGCCTGAAACAGACCTGCATGAAGTTCTACGCACGCGTCTGCAGAAGTGGCTCAGGCCTGGTTGGCCGCCAGCTTGAGGAGTTCCTGAACCAGAGCTCGCCCTTCTAC

Ensembl | 인체 수납 번호

ENSG00000120885

NCBI 수납 번호

NM_001831

배송 상태

ambient

저장 온도

−20°C

유전자 정보

human ... CLU(1191) , CLU(1191)

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable

시험 성적서(COA)

제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Lihua Mu et al.
Bioengineered, 11(1), 472-483 (2020-04-07)
Recent focus has turned to secretory clusterin (sCLU) as a key contributor to chemoresistance of anticancer agents, but the role of sCLU on chemotherapy drug response to gastric cancer cells is not fully understood. Previous research found that sCLU was
Na Fu et al.
Life sciences, 256, 117911-117911 (2020-06-07)
To explore the potential regulatory mechanism of differentially expressed mRNAs in Hepatitis C virus (HCV)-related hepatocellular carcinoma (HCC). Patients with HCV-related HCC and age- and gender-matched healthy subjects were enrolled. Differentially expressed mRNAs in the plasma were detected by digital
Xiaohui Wang et al.
Current pharmaceutical biotechnology, 21(2), 131-139 (2019-08-23)
The aim of the study was to investigate the expression of sCLU in relation to the clinicopathological features and prognosis of patients with untreated High-Grade Osteosarcoma (HGOS) and to evaluate sCLU as a target for osteosarcoma (OS) therapies. The expression
Chiara Tarquini et al.
Aging, 12(11), 10129-10146 (2020-06-10)
Osteoarthritis (OA) is the most common joint disease characterized by destruction of articular cartilage. OA-induced cartilage degeneration causes inflammation, oxidative stress and the hypertrophic shift of quiescent chondrocytes. Clusterin (CLU) is a ubiquitous glycoprotein implicated in many cellular processes and
Alice Filippini et al.
Glia, 69(3), 681-696 (2020-10-13)
The progressive neuropathological damage seen in Parkinson's disease (PD) is thought to be related to the spreading of aggregated forms of α-synuclein. Clearance of extracellular α-synuclein released by degenerating neurons may be therefore a key mechanism to control the concentration
모든 관련된 서류 보기

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.