설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
CCCTGTGATTGATGTGTTGCTGGGAGAACAGGATCAATATGTCCCAAATAATACAGATTTATCAGAGGACTCAGAGAGAGTAATGATAATTACCGGACCAAACATGGGTGGAAAGAGCTCCTACATAAAACAAGTTGCATTGATTACCATCATGGCTCAGATTGGCTCCTATGTTCCTGCAGAAGAAGCGACAATTGGGATTGTGGATGGCATTTTCACAAGGATGGGTGCTGCAGACAATATATATAAAGGACAGAGTACATTTATGGAAGAACTGACTGACACAGCAGAAATAATCAGAAAAGCAACATCACAGTCCTTGGTTATCTTGGATGAACTAGGAAGAGGGACGAGCACTCATGATGGAATTGCCATTGCCTATGCTACACTTGAGTATTTCATCAGAGATGTGAAATCCTTAACCCTGTTTGTCACCCATTATCCGC
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... MSH3(4437) , MSH3(4437)
관련 카테고리
일반 설명
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
가장 최신 버전 중 하나를 선택하세요:
Daniel J McGrail et al.
Cancer cell, 37(3), 371-386 (2020-02-29)
Deficient DNA mismatch repair (dMMR) induces a hypermutator phenotype that can lead to tumorigenesis; however, the functional impact of the high mutation burden resulting from this phenotype remains poorly explored. Here, we demonstrate that dMMR-induced destabilizing mutations lead to proteome
Sarah J Young et al.
Cell reports, 33(3), 108289-108289 (2020-10-22)
MutSα and MutSβ play important roles in DNA mismatch repair and are linked to inheritable cancers and degenerative disorders. Here, we show that MSH2 and MSH3, the two components of MutSβ, bind SLX4 protein, a scaffold for the assembly of
Yan Li et al.
Journal of molecular histology, 46(4-5), 357-364 (2015-06-21)
Multidrug resistance-associated protein 1 (MRP1) belongs to ATP-binding cassette transporters family. The overexpression of MRP1 is predominantly related with the failure of chemo-radiotherapy in various tumors. However, its possible role in hypertrophic scar (HS) is hardly investigated. Here we showed
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.