콘텐츠로 건너뛰기
Merck
모든 사진(1)

문서

EHU056051

Sigma-Aldrich

MISSION® esiRNA

targeting human SPTA1

로그인조직 및 계약 가격 보기
모든 사진(1)

About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

제품 라인

MISSION®

형태

lyophilized powder

esiRNA cDNA 표적 서열

CCTTGTTGCCTCTGAAGGACTGTTTCACAGTCACAAGGGACTTGAGAGAAATCTTGCTGTCATGAGTGACAAGGTGAAGGAGTTATGTGCTAAAGCAGAGAAGCTGACACTTTCCCATCCTTCAGATGCACCTCAGATCCAGGAGATGAAAGAAGATCTGGTCTCCAGCTGGGAGCATATTCGTGCCCTGGCCACCAGCAGATATGAAAAACTGCAGGCTACTTATTGGTACCATCGATTTTCATCTGACTTTGATGAACTCTCAGGCTGGATGAACGAGAAGACTGCTGCGATCAATGCTGATGAGCTGCCAACAGATGTGGCTGGTGGAGAAGTTCTGCTGGACAGGCATCAGCAGCATAAGCATGAGATTGACTCTTACGATGACCGATTTCAATCTGCTGATGAGACTGGTCAAGACCTCGTGAATGCCAATCATGAAGCCTC

Ensembl | 인체 수납 번호

ENSG00000163554

NCBI 수납 번호

NM_003126

배송 상태

ambient

저장 온도

−20°C

유전자 정보

human ... SPTA1(6708) , SPTA1(6708)

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable

시험 성적서(COA)

제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

N C Hait et al.
Oncogenesis, 4, e156-e156 (2015-06-09)
Estrogen receptor-α (ERα)-negative breast cancer is clinically aggressive and does not respond to conventional hormonal therapies. Strategies that lead to re-expression of ERα could sensitize ERα-negative breast cancers to selective ER modulators. FTY720 (fingolimod, Gilenya), a sphingosine analog, is the
Yunze Xu et al.
Oncotarget, 7(3), 3233-3244 (2015-12-18)
Adrenocortical carcinoma (ACC) is a rare endocrine tumor with a very poor prognosis. Sphingosine kinase 1 (SphK1), an oncogenic kinase, has previously been found to be upregulated in various cancers. However, the role of the SphK1 in ACC has not
Evgeny V Berdyshev et al.
PloS one, 6(1), e16571-e16571 (2011-02-10)
Earlier we have shown that extracellular sphingosine-1-phosphate (S1P) induces migration of human pulmonary artery endothelial cells (HPAECs) through the activation of S1P(1) receptor, PKCε, and PLD2-PKCζ-Rac1 signaling cascade. As endothelial cells generate intracellular S1P, here we have investigated the role
T H Beckham et al.
Oncogenesis, 2, e49-e49 (2013-06-05)
Acid ceramidase (AC) is overexpressed in most prostate tumors and confers oncogenic phenotypes to prostate cancer cells. AC modulates the cellular balance between ceramide, sphingosine and sphingosine 1-phosphate (S1P). These bioactive sphingolipids have diverse, powerful and often oppositional impacts on
Panfeng Fu et al.
The Journal of biological chemistry, 291(53), 27187-27203 (2016-11-20)
Hepatocyte growth factor (HGF) signaling via c-Met is known to promote endothelial cell motility and angiogenesis. We have previously reported that HGF stimulates lamellipodia formation and motility of human lung microvascular endothelial cells (HLMVECs) via PI3K/Akt signal transduction and reactive

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.