콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

EHU053981

Sigma-Aldrich

MISSION® esiRNA

targeting human PPL

로그인조직 및 계약 가격 보기


About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

제품 라인

MISSION®

양식

lyophilized powder

esiRNA cDNA 표적 서열

ACAGACAGCCTCAGCCAGATGGAGACCAAGCTGAAGAACCAGAAGAACCTGCTAGATGAGATAGCAAGTAGGGAGCAGGAAGTACAGAAGATCTGTGCCAATTCCCAGCAGTACCAGCAAGCTGTAAAGGACTATGAGTTAGAAGCAGAAAAACTAAGGTCTCTTCTCGACTTGGAGAATGGAAGGAGAAGCCACGTGAGCAAGAGAGCCAGGCTCCAATCTCCTGCCACCAAAGTGAAGGAAGAGGAAGCAGCACTTGCCGCCAAGTTCACTGAAGTTTATGCCATCAACAGACAGAGGCTGCAGAATCTGGAGTTTGCTCTGAATCTCCTCAGACAGCAGCCGGAAGTAGAAGTGACCCATGAGACCCTGCAAAGGAATAGGCCGGACTCTGGAGTGGAGGAGGCGTGGAAGATCAGGAAGGAACTGGATGAGGAGACTGAGCGGAG

Ensembl | 인체 수납 번호

NCBI 수납 번호

배송 상태

ambient

저장 온도

−20°C

유전자 정보

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable


가장 최신 버전 중 하나를 선택하세요:

시험 성적서(COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our 문서 section.

도움이 필요하시면 연락하세요. 고객 지원 부서

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Yurie Tonoike et al.
BMC cell biology, 12, 41-41 (2011-09-29)
We previously reported that periplakin (PPL) is downregulated in human esophageal cancer tissues compared to the adjacent non-cancer epithelium. Thus PPL could be a useful marker for detection of early esophageal cancer and evaluation of tumor progression, but largely remains
Hui Mei Lee et al.
Scientific reports, 9(1), 2357-2357 (2019-02-23)
The use of EGFR inhibitors on oral squamous cell carcinoma (OSCC) as monotherapy yielded modest clinical outcomes and therefore would benefit from biomarkers that could predict which patient subsets are likely to respond. Here, we determined the efficacy of erlotinib

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.