설명
Powered by Eupheria Biotech
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
CTTTTGGGACCAGCAACATTCAGGAGCAGCTCCTGCCGTTCGACCTATCAATATTCAAGTCCCTGCATCAGGTGGAGATAAGTCACTGTGATGCTAAGCACATCAGAGGGCTGGTCGCATCGAAGCCCACCTTAGCCACGCTGAGTGTCCGCTTCTCAGCAACCTCGATGAAGGAAGTCCTTGTTCCTGAAGCCTCAGAATTTGATGAGTGGGAGCCTGAAGGCACAACCCTAGAAGGCCCTGTGACTGCCGTCATCCCCACTTGGCAGGCATTGACCACGCTTGACCTGAGCCACAACAGCGTCTCCGAGATCGACGAGTCTGTGAAACTGATCCCAAAGATTGAGTTCCTGGACCTGAGTCACAATGGATTGCTGGTTGTGGACAATCTGCAGCACCTGTATAACCTTGTGCATCTGGACCTGTCCTACAACAAGCTCTCCTCCTTGG
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... NISCH(11188) , NISCH(11188)
일반 설명
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
가장 최신 버전 중 하나를 선택하세요:
Yue-Min Ding et al.
Neural regeneration research, 12(10), 1687-1694 (2017-11-25)
A previous study by our group found that inhibition of nischarin promotes neurite outgrowth and neuronal regeneration in Neuro-2a cells and primary cortical neurons. In recent years, more and more studies have shown that nanomaterials have good prospects in treatment
Moran Dvela-Levitt et al.
Cell, 178(3), 521-535 (2019-07-28)
Intracellular accumulation of misfolded proteins causes toxic proteinopathies, diseases without targeted therapies. Mucin 1 kidney disease (MKD) results from a frameshift mutation in the MUC1 gene (MUC1-fs). Here, we show that MKD is a toxic proteinopathy. Intracellular MUC1-fs accumulation activated
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.