설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
형태
lyophilized powder
esiRNA cDNA 표적 서열
TCCTATGGGACCTTCCTGTGTCGCTGCCACCAGGGCTATGAGCTGCATCGGGATGGCTTCTCCTGCAGTGATATTGATGAGTGTAGCTACTCCAGCTACCTCTGTCAGTACCGCTGCATCAACGAGCCAGGCCGTTTCTCCTGCCACTGCCCACAGGGTTACCAGCTGCTGGCCACACGCCTCTGCCAAGACATTGATGAGTGTGAGTCTGGTGCGCACCAGTGCTCCGAGGCCCAAACCTGTGTCAACTTCCATGGGGGCTACCGCTGCGTGGACACCAACCGCTGCGTGGAGCCCTACATCCAGGTCTCTGAGAACCGCTGTCTCTGCCCGGCCTCCAACCCTCTATGTCGAGAGCAGCCTTCATCCATTGTGCACCGCTACATGACCATCACCTCGGA
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... EFEMP2(30008) , EFEMP2(30008)
일반 설명
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
시험 성적서(COA)
제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.
Hao Liu et al.
Journal of biochemistry, 166(6), 495-502 (2019-08-10)
MicroRNAs (miRNAs) serve as key regulators in human disorders. Previous research reported that miR-211-5p is down-regulated in osteoarthritis (OA) and that Fibulin-4 inhibits chondrocyte differentiation. However, the role of miR-211-5p in the development of OA has not been clarified, and
Seung Jae Shin et al.
Arteriosclerosis, thrombosis, and vascular biology, 40(8), 1905-1917 (2020-06-26)
Remodeling of the extracellular matrix plays a vital role in cardiovascular diseases. Using a mouse model of postnatal ascending aortic aneurysms (termed Fbln4SMKO), we have reported that abnormal mechanosensing led to aneurysm formation in Fbln4SMKO with an upregulation of the
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.