설명
Powered by Eupheria Biotech
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
GATTCTCCAACGACCAGACCATCGAGCTGGAGAAGAAATTCGAGACGCAGAAATATCTCTCTCCGCCCGAGAGGAAGCGTCTGGCCAAGATGCTGCAGCTCAGCGAGAGACAGGTCAAAACCTGGTTTCAGAATCGACGCGCTAAATGGAGGAGACTAAAACAGGAGAACCCTCAAAGCAATAAAAAAGAAGAACTGGAAAGTTTGGACAGTTCCTGTGATCAGAGGCAAGATTTGCCCAGTGAACAGAATAAAGGTGCTTCTTTGGATAGCTCTCAATGTTCGCCCTCCCCTGCCTCCCAGGAAGACCTTGAATCAGAGATTTCAGAGGATTCTGATCAGGAAGTGGACATTGAGGGCGATAAAAGCTATTTTAATGCTGGATGATGACCACTGGCATTG
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... HHEX(3087) , HHEX(3087)
일반 설명
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
가장 최신 버전 중 하나를 선택하세요:
R M Kershaw et al.
Oncogenesis, 6(6), e346-e346 (2017-06-13)
Breast tumours progress from hyperplasia to ductal carcinoma in situ (DCIS) and invasive breast carcinoma (IBC). PRH/HHEX (proline-rich homeodomain/haematopoietically expressed homeobox) is a transcription factor that displays both tumour suppressor and oncogenic activity in different disease contexts; however, the role
Eudmar Marcolino et al.
Oncogenesis, 9(2), 10-10 (2020-02-06)
Cancer cells go through a process known as epithelial-mesenchymal transition (EMT) during which they acquire the ability to migrate and invade extracellular matrix. Some cells also acquire the ability to move across a layer of endothelial cells to enter and
Philip Kitchen et al.
Cancer research, 80(4), 757-770 (2019-12-18)
Aberrant Notch and Wnt signaling are known drivers of cholangiocarcinoma (CCA), but the underlying factors that initiate and maintain these pathways are not known. Here, we show that the proline-rich homeodomain protein/hematopoietically expressed homeobox (PRH/HHEX) transcription factor forms a positive
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.