설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
ATCCACTTCACCCTGATCCAGGCGTTTTGCTGCGAGAACGACATCAACATCCTGCGCGTCAGCAACCCGGGCCGGCTGGCGGAGCTCCTGCTCTTGGAGACCGACGCTGGCCCCGCGGCGAGCGAGGGCGCCGAGCAGCCCCCGGACCTGCACTGCGTGCTGGTGACGAATCCACATTCATCTCAATGGAAGGATCCTGCCTTAAGTCAACTTATTTGTTTTTGCCGGGAAAGTCGCTACATGGATCAATGGGTTCCAGTGATTAATCTCCCTGAACGGTGATGGCATCTGAATGAAAATAACTGAACCAAATTGCACTGAAGTTTTTGAAATACCTTTGTAGTTACTCAAGCAGTTACTCCCTACACTGATGCAAGGATTACAGAAACTGATGCCAAGGG
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... GADD45A(1647) , GADD45A(1647)
일반 설명
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
적합한 제품을 찾을 수 없으신가요?
당사의 제품 선택기 도구.을(를) 시도해 보세요.
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
가장 최신 버전 중 하나를 선택하세요:
Experimental cell research, 370(2), 718-724 (2018-07-29)
Long non-coding RNA (lncRNA) are key regulatory molecules that are implicated in diverse biological processes and human diseases, including preeclampsia. However, their expression and functions in the progression of preeclampsia remains largely unclear. In this study, lncRNA DLX6-AS1 was confirmed
Molecular therapy. Nucleic acids, 22, 382-395 (2020-11-25)
Long noncoding RNAs (lncRNAs), genomic "dark matter," are deeply involved in diverse biological processes. The lncRNA nuclear paraspeckle assembly transcript 1 (NEAT1) is a highly participatory lncRNA; however, its roles in gastric cancer (GC) remain largely unexplored. Here, we demonstrated
Gene, 763, 145030-145030 (2020-08-07)
To investigate the impact and the mechanism of Gadd45α mediating p38MAPK pathway on the retinal ganglion cells (RGCs) injury in chronic ocular hypertension (COH) rats. COH model in rats were established and intraocular pressure (IOP) was tested. Retrograde labeling was
Journal of molecular cell biology, 9(4), 338-349 (2017-10-11)
Retinoic acid (RA), a bioactive metabolite of vitamin A, is a critical mediator of cell differentiation. RA blocks adipogenesis, but mechanisms remain to be established. ZFP423 is a key transcription factor maintaining white adipose identity. We found that RA inhibits
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.