설명
Powered by Eupheria Biotech
제품 라인
MISSION®
형태
lyophilized powder
esiRNA cDNA 표적 서열
ATGACACCAAGGACCAGAGCCCCTCACGGGCACCAGGGCTTCGCCAGCGGGCCAGCAACAAAGTGCAAGATTCTGCCCCCGTGGAGACTCCCAGAGGGAAGCCCCCACTCAACACCCGCTCCCAGGCTCCGCTTCTCCGATGGGTCCTTACACTCAGCTTTCTGGTGGCGACAGTTGCTGTAGGGCTTTATGCCATGTGAATGCAGGCATGCTGGCTCCCAGGGCCATGAACTTTGTCCGGTGGAAGGCCTTCTTTCTAGAGAGGGAATTCTCTTGGCTGGCTTCCTTACCGTGGGCACTGAAGGCTTTCAGGGCCTCCAGCCCTCTCACTGTGTCCCTCTCTCTGGAAAGGAGGAAGGAGCCTATGGCATCTTCCCCAACGAAAAGCACATCCAGGCAAT
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... HMOX1(3162) , HMOX1(3162)
일반 설명
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
시험 성적서(COA)
제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.
Kritika Sudan et al.
Free radical biology & medicine, 137, 131-142 (2019-04-27)
Heme oxygenase (HO)-1, a stress-inducible enzyme that converts heme into carbon monoxide (CO), iron and biliverdin, exerts important anti-inflammatory effects in activated macrophages. HO-1 expression is mainly governed by a mutual interplay between the transcriptional factor NRF2 and the nuclear
Hongyan Lu et al.
Frontiers in cell and developmental biology, 8, 584653-584653 (2020-10-27)
We have shown previously that adipose stromal cell (ASC)-derived conditioned media (CM) limited lung injury, endothelial barrier dysfunction, and apoptosis. Here, we used endothelial hyperpermeability and apoptosis assays to investigate how concentration processes affect endothelium-directed bioactivity of ASC-CM and to
Yunjun Xiao et al.
Oxidative medicine and cellular longevity, 2018, 3295807-3295807 (2018-10-18)
Curcumin has several therapeutic properties such as anti-inflammatory effect. Heme oxygenase-1 (HO-1) has been showed to have cytoprotective effects in some pathological conditions. However, the role of HO-1 in anti-inflammatory effect of curcumin is unknown. In this study, we investigate
Seulgi Namkoong et al.
Journal of medicinal food, 20(9), 873-881 (2017-09-12)
Crosstalk between adipocytes and macrophages has been suggested to play a crucial role in metabolic disorders such as obesity, insulin resistance, and type 2 diabetes. The objective of this study was to evaluate the effect of nobiletin on the interaction
Chaoying Zhu et al.
Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology, 46(2), 644-653 (2018-04-05)
Nucleus pulposus cell (NPC) apoptosis is the main factor in intervertebral disc degeneration (IDD); thus, inhibiting the excessive apoptosis of nucleus pulposus cells may be a potential way to alleviate IDD. The effect of Hemeoxygenase-1 (HO-1) on human NPC apoptosis
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.