콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

EHU049781

Sigma-Aldrich

MISSION® esiRNA

targeting human NOX5

로그인조직 및 계약 가격 보기
모든 사진(1)

About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

100

제품 라인

MISSION®

형태

lyophilized powder

esiRNA cDNA 표적 서열

GCTGTCGAGGAGTGTGACAATGAGAAAGAGTCAAAGGTCGTCCAAGGGCTCTGAGATACTTTTGGAGAAACACAAATTCTGTAACATCAAGTGCTACATCGATGGGCCTTATGGGACCCCCACCCGCAGGATCTTTGCCTCTGAGCATGCCGTGCTCATCGGGGCAGGCATCGGCATCACCCCCTTTGCTTCCATTCTGCAGAGTATCATGTACAGGCACCAGAAAAGAAAGCATACTTGCCCCAGCTGCCAGCACTCCTGGATCGAAGGTGTCCAAGACAACATGAAGCTCCATAAGGTGGACTTTATCTGGATCAACAGAGACCAGCGGTCTTTCGAGTGGTTTGTGAGCCTGCTGACTAAACTGGAGATGGACCAGGCCGAGGAGGCTCAATACGGCCGCTTCCTGGAGCTGCATATGTACATGACATCTGCACTGGGCAAGAATGACATG

Ensembl | 인체 수납 번호

ENSG00000137808

NCBI 수납 번호

NM_024505

배송 상태

ambient

저장 온도

−20°C

유전자 정보

human ... NOX5(79400) , NOX5(79400)

관련 카테고리

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable

시험 성적서(COA)

제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Dan Li et al.
The Journal of pharmacology and experimental therapeutics, 360(1), 14-22 (2016-10-21)
We have shown that NADPH oxidase (NOX)5-S may mediate the acid-induced decrease in cell apoptosis. However, mechanisms of NOX5-S-dependent decrease in cell apoptosis are not fully understood. In this study, we found that silencer-of-death domain (SODD) was significantly increased in
Farhan Rizvi et al.
PloS one, 7(4), e34440-e34440 (2012-04-19)
To determine whether NOX 5 is expressed in rabbit corneal stromal cells (RCSC). NADPH oxidases (NOXes) are enzymes that preferentially use NADPH as a substrate and generate superoxide. Several isoforms of NOXes function as multi-protein complexes while NOX5 and DUOXs
Jie Chen et al.
Signal transduction and targeted therapy, 5(1), 139-139 (2020-08-15)
Reactive oxygen species (ROS) localized at the precise subcellular compartments are essential for regulating the activity of signaling proteins. Furthermore, ROS are master regulators of tumor malignant progression that respond to a diverse set of environmental stress, especially hypoxia. NADPH
Hope K A Gole et al.
PloS one, 9(8), e105337-e105337 (2014-08-22)
NADPH oxidase (NOX) is the primary source of reactive oxygen species (ROS) in vascular smooth muscle cells (SMC) and is proposed to play a key role in redox signaling involved in the pathogenesis of cardiovascular disease. Growth factors and cytokines
S Carnesecchi et al.
Free radical biology & medicine, 84, 22-29 (2015-03-24)
Reactive oxygen species (ROS) are key modulators of apoptosis and carcinogenesis. One of the important sources of ROS is NADPH oxidases (NOXs). The isoform NOX5 is highly expressed in lymphoid tissues, but it has not been detected in any common

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.