설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
형태
lyophilized powder
esiRNA cDNA 표적 서열
TCAAACCAGACCGTGAAGAAATTGTAGAAAATCCAAGTTCTTCAGCTTCTGAATCTAATACAAGTACTTCCATTGTAAACAGAATACATCCAAGTACTGCCAGCACGGTAGTGACACCAGCAGCAGTTCTTCCTGGATTGGCACAGGTGATAACTGCTGTATCTGCTCAGCAGAATTCTAATTTGATTCCCAAAGTCTTAATCCCTGTTAATAGCATTCCCACCTACAATGCTGCATTGGATAACAATCCCCTTTTACTTAACACCTACAACAAGTTCCCTTACCCAACAATGTCAGAAATTACAGTTCTTTCTGCTCAAGCAAAATATACAGAGGAACAGATCAAGATATGGTTTTCAGCCCAACGTTTAAAACATGGTGTTAGTTGGACTCCCGAGGAAGT
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... ZHX1(11244) , ZHX1(11244)
일반 설명
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
시험 성적서(COA)
제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.
Ryuk-Jun Kwon et al.
PloS one, 11(11), e0165516-e0165516 (2016-11-12)
Zinc-fingers and homeoboxes 1 (ZHX1) is a transcription repressor that has been associated with the progressions of hepatocellular carcinoma, gastric cancer, and breast cancer. However, the functional roles of ZHX1 in cholangiocarcinoma (CCA) have not been determined. We investigated the
Yi-Kai Pan et al.
Apoptosis : an international journal on programmed cell death, 25(1-2), 73-91 (2019-11-27)
Weightlessness-induced cardiovascular dysfunction can lead to physiological and pathological consequences. It has been shown that spaceflight or simulated microgravity can alter expression profiles of some microRNAs (miRNAs). Here, we attempt to identify the role of miRNAs in human umbilical vein
Jinping Guan et al.
American journal of translational research, 9(5), 2457-2465 (2017-06-01)
MicroRNAs play an important role in cell proliferation, apoptosis, differentiation, and invasion by regulating the expression of various genes. For example, the downregulation of microRNA-199a-3p (miR-199a-3p) that is noted in numerous human malignancies, including hepatocellular carcinoma (HCC), results in a
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.