설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
GCCTTCAACCACTCAGACCTGGACGCCGAGCTGAGGCGGCTCTTCCGCGAGCGCTATCGGCTGCACCCCAAGTTCGTGGCGGCCGTGCACTACGAGCAGCCCACCATCCAGATCGAGCTGCGGCAGAACACGTCTCAGAAGGCCGCCGGTGACGTGGATATCGGCGATGCCGCCTACTACTTCGAGAGGGACATCAAGGGCGAGTCTCTATTCCAGGGCCGCGGCGGCCTGGACTTGCGCGTGCGCGGAGAACCCCTGCAGGTGGAGCGCACGCTCATCTATTACCTGGACGAGATTCCCCCGAAGTTCTCCATGAAGCGCCTCACCGCCGGCCTCATCGCCGTCATCGTGGTGGTCGTGGTGGCCCTCGTCGCCGGCATGGCCGTCCTGGTGATCACCAACCGGAGAAAGTCGGGGAAGTACAAGAAGGTGGAGATCAAGGAACTGGGGGAGTT
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... TACSTD2(4070) , TACSTD2(4070)
일반 설명
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
가장 최신 버전 중 하나를 선택하세요:
Vandana Sekhar et al.
PLoS pathogens, 14(3), e1006916-e1006916 (2018-03-15)
Entry of hepatitis C virus (HCV) into hepatocytes is a complex process that involves numerous cellular factors, including the scavenger receptor class B type 1 (SR-B1), the tetraspanin CD81, and the tight junction (TJ) proteins claudin-1 (CLDN1) and occludin (OCLN).
Bin Wu et al.
Experimental and therapeutic medicine, 14(3), 1947-1952 (2017-10-01)
Human trophoblastic cell-surface marker, tumor-associated calcium signal transducer 2 (TROP2), is a newly identified marker that has a vital role in the proliferation and invasion of various tumors. However, its specific function in ovarian cancer has not been researched. The
Chuan-Jin Wu et al.
Cells, 9(4) (2020-04-25)
The homologs EpCAM and TROP2, which both interact with claudin-1 and claudin-7, are frequently coexpressed in epithelia including skin. Intestine uniquely expresses high levels of EpCAM but not TROP2. We previously identified EpCAM as a substrate of the membrane-anchored protease
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.