콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

EHU047751

Sigma-Aldrich

MISSION® esiRNA

targeting human CX3CL1

로그인조직 및 계약 가격 보기
모든 사진(1)

About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

100

제품 라인

MISSION®

형태

lyophilized powder

esiRNA cDNA 표적 서열

CCACCTTCTGCCATCTGACTGTCCTGCTGGCTGGACAGCACCACGGTGTGACGAAATGCAACATCACGTGCAGCAAGATGACATCAAAGATACCTGTAGCTTTGCTCATCCACTATCAACAGAACCAGGCATCATGCGGCAAACGCGCAATCATCTTGGAGACGAGACAGCACAGGCTGTTCTGTGCCGACCCGAAGGAGCAATGGGTCAAGGACGCGATGCAGCATCTGGACCGCCAGGCTGCTGCCCTAACTCGAAATGGCGGCACCTTCGAGAAGCAGATCGGCGAGGTGAAGCCCAGGACCACCCCTGCCGCCGGGGGAATGGACGAGTCTGTGGTCCTGGAGCCCGAAGCCACAGGCGAAAGCAGTAGCCTGGAGCCGACTCCTTCTTCCCAGGAAGC

Ensembl | 인체 수납 번호

ENSG00000006210

NCBI 수납 번호

NM_002996

배송 상태

ambient

저장 온도

−20°C

유전자 정보

human ... CX3CL1(6376) , CX3CL1(6376)

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable

시험 성적서(COA)

제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Ju-Fang Liu et al.
Oncotarget, 8(33), 54136-54148 (2017-09-15)
Osteosarcoma is the most common primary bone tumor in children and teens. The exact molecular mechanism underlying osteosarcoma progression still remains unclear. The CX3CL1/fractalkine has been implicated in various tumors but not in osteosarcoma. This study is the first to
Claudia Geismann et al.
International journal of molecular sciences, 19(6) (2018-06-06)
Pancreatic ductal adenocarcinoma (PDAC) is one of the most lethal malignant neoplasms and registers rising death rates in western countries. Due to its late detection in advanced stages, its extremely aggressive nature and the minimal effectiveness of currently available therapies
Feifei Ren et al.
Immunology and cell biology, 97(5), 457-469 (2018-12-24)
Mutations in the isocitrate dehydrogenase (IDH) 1 gene, especially the R132H mutation, have been reported to be associated with a better prognosis in glioma patients. However, the underlying molecular mechanisms are not yet well understood. Many factors may contribute to
Monika Siwetz et al.
The American journal of pathology, 185(5), 1334-1343 (2015-03-15)
The pathogenesis of preeclampsia (PE) includes the release of placental factors into the maternal circulation, inducing an inflammatory environment in the mother. One of the factors may be the proinflammatory chemokine fractalkine, which is expressed in the syncytiotrophoblast of human
Monika Siwetz et al.
Histochemistry and cell biology, 143(6), 565-574 (2015-01-09)
The chemokine fractalkine (CX3CL1) recently attracted increasing attention in the field of placenta research due to its dual nature, acting both as membrane-bound and soluble forms. While the membrane-bound form mediates flow-resistant adhesion of leukocytes to endothelial and epithelial cells

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.