설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
TGGCTGCCATCCTTTACTTCTACCTGCTCTTCCCCAACTCCCTGAGCCTGAGTGAGCGTGTGGCCATCATCAAAGGCACGTATGAGCCTGACGAGGACTGGGAGGAGCAGCGGGAAGAGCGGAAGAAGACCATGGAGCTGACCACCCGCTGACCAGTGTCAGGCAGGGGCCAGCCCCTCAGCCCCTGAGCCAAGGGGGAAAAGAAGAAAAAGTACCTAACACAAGCTTCCTTTTTGCACAACCGGTCCTCTTGGCTGAGGAGGAGGAGCTGGTCACCCTGGCTGCACAGTTAGAGAGGGGAGAAGGAACCCATGATGGGACTCCTGGGGTAGGGGCCAGGGGCTGGGGTCTGCTGGGGACAGGTCTCTCTGGGACAGACCTCAGAGATTGTGAATGCAGTGCCA
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
일반 설명
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
가장 최신 버전 중 하나를 선택하세요:
Michihiro Kudou et al.
International journal of oncology, 50(5), 1857-1867 (2017-03-31)
Previous studies described that the expression of aquaporin 5 (AQP5) was altered in tumors of various organs. AQP5 is attracting attention as a new cancer therapeutic target. In the present study, heat shock-induced changes in AQP5 expression were evaluated by
Chen Chen et al.
Molecular carcinogenesis, 56(12), 2692-2705 (2017-08-24)
Epithelial-mesenchymal transition (EMT) has emerged as an important determinant role in colorectal cancer (CRC) metastasis. It has been reported that aquaporin 5 (AQP5) is closely linked to CRC metastasis. However, the effect of AQP5 on the EMT process of CRC
Xueqing Li et al.
OncoTargets and therapy, 11, 3359-3368 (2018-06-21)
Based on the functionality of AQP-5 characterized in various physiological processes, our study aimed to investigate the effect of AQP-5 silencing by siRNA interference on chemosensitivity of breast cancer cells. The expression levels of AQP-5 mRNA in different experimental groups
ChunXiao Yan et al.
Journal of ovarian research, 7, 78-78 (2014-10-10)
Recent studies suggested that aquaporins 5 (AQP5) was associated with many kinds of cancers and regulated many processes of various kinds of cancer cells. Our previous studies also demonstrated that AQP5 was highly expressed in epithelial ovarian cancer and contributed
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.