설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
형태
lyophilized powder
esiRNA cDNA 표적 서열
CAAGGTGATTTCAAAGGAGCAAGTAATGTTTATGTCAGATAGTGTCTTTACAACCAGAAATCTTCTTGAACAGATTGTCCTGCCTTTAAAAAAATTGACTTATATCTACTCAGTTGTATTAACCTTGGTGTCAGAAAAAGTTTATGATTGGAAAGTTTTAGCTGATGTCCTGGGTTACTCACATCTGTCCCTGGAAGATTTTGATCAAATTCAAGCAGACAAAGAATCAGAGAAAGTTTCTTATGTTATAAAGAAGTTAAAGGAAGATTGCCACACAGAGAGAAATACAAGGAAGTTTCTGTATGAACTTATTGTGGCTCTTCTGAAAATGGATTGCCAAGAGTTAGTCGCACGTCTCATCCAAGAAGCTGCTGTTCTGACTTCAGCTGTCAAGCTTGGAAAAGG
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... MACC1(346389) , MACC1(346389)
일반 설명
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
시험 성적서(COA)
제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.
Qiang Zhang et al.
Acta biochimica et biophysica Sinica, 50(8), 748-756 (2018-07-03)
One of the major obstacles hindering the treatment of lung cancer (LC) is chemoresistance; however, its mechanism remains unclear. The overexpression of the metastasis-associated in colon cancer 1 (MACC1) gene has been demonstrated to reverse chemoresistance. In the current study
Mingliang Lu et al.
Experimental and therapeutic medicine, 17(4), 2807-2814 (2019-03-25)
The mortality and incidence rates of colorectal cancer (CRC) vary widely worldwide. miR-338-3p inhibits tumor cell proliferation in several types of cancer, however, the role of miR-338-3p on CRC remains unknown. The aim of the current study was to investigate
C J Wei et al.
Neoplasma, 67(3), 537-546 (2020-02-18)
Gastric cardia adenocarcinoma (GCA) is one of the most common types of cancer and the incidence is increasing globally. MicroRNAs (miRNAs) have been reported to play critical roles in the progression of GCA. However, the exact role of miR-638 in
Yaoqing Li et al.
Molecular medicine reports, 12(1), 426-434 (2015-03-05)
Metastasis-associated in colon cancer-1 (MACC1) is a newly identified gene that is involved in the development and progression of hepatocellular carcinoma (HCC), however its investigation has not been comprehensive. In the present study, in vitro techniques, including immunohistochemistry, western blotting
Aiko Sueta et al.
International journal of oncology, 46(5), 2143-2153 (2015-03-05)
The newly identified gene, metastasis‑associated in colon cancer 1 (MACC1), is suggested to be a transcriptional regulator of c‑Met, leading to cancer progression in colorectal cancer. To date however, little is known of the role of MACC1 in breast cancer.
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.