콘텐츠로 건너뛰기
Merck
모든 사진(1)

Key Documents

EHU044501

Sigma-Aldrich

MISSION® esiRNA

targeting human TP53INP1

로그인조직 및 계약 가격 보기
모든 사진(1)

About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

제품 라인

MISSION®

형태

lyophilized powder

esiRNA cDNA 표적 서열

TGGGCCAACTAAAGACAAGGTTTTGAAATCTCAGCTATAAAAGACATCCAGCCAAACTCTCAGTCTTGCCTTAACAATGTTCCAGAGGCTGAATAAAATGTTTGTGGGTGAAGTCAGTTCTTCCTCCAACCAAGAACCAGAATTCAATGAGAAAGAAGATGATGAATGGATTCTTGTTGACTTCATAGATACTTGCACTGGTTTCTCAGCAGAAGAAGAAGAAGAAGAGGAGGACATCAGTGAAGAGTCACCTACTGAGCACCCTTCAGTCTTTTCCTGTTTACCGGCATCTCTTGAGTGCTTGGCTGATACAAGTGATTCCTGCTTTCTCCAGTTTGAGTCATGTCCAATGGAGGAGAGCTGGTTTATCACCCCACCCCCATGTTTTACTGCAGGTGGATTAACCACTATCAAGGTGGAAACAAGTCCTATGGAAAACCTTCTCATTGAACATCCCAGCA

Ensembl | 인체 수납 번호

ENSG00000164938

NCBI 수납 번호

NM_033285

배송 상태

ambient

저장 온도

−20°C

유전자 정보

human ... TP53INP1(94241) , TP53INP1(94241)

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable

시험 성적서(COA)

제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Yonggang Huang et al.
Journal of Cancer, 11(22), 6545-6555 (2020-10-14)
Liver tumor-initiating cells (T-ICs) contribute to tumorigenesis, progression, recurrence and drug resistance of hepatocellular carcinoma (HCC). However, the underlying mechanism for the propagation of liver T-ICs remains unclear. In the present study, our finding shows that miR-96 is upregulated in
Xiaohuan Xia et al.
Stem cell research & therapy, 10(1), 282-282 (2019-09-25)
Recent studies suggested that miR-17~106 family was involved in the regulation of neural stem/progenitor cells (NPCs). However, distinct function of each family member was reported in regulating stem cells within and without the brain. Hence, to investigate the roles of
Mingming Zhu et al.
Cancer medicine, 9(22), 8639-8649 (2020-09-29)
Recently, long noncoding RNAs (lncRNAs) were recognized as significant therapeutic targets in tumors. Our previous microarray analysis showed that lncRNA TCONS_000026334 expression was reduced in metastatic colorectal cancer (CRC) tissues. The objective of this study was to research the biological

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.