콘텐츠로 건너뛰기
Merck
모든 사진(1)

문서

EHU043091

Sigma-Aldrich

MISSION® esiRNA

targeting human ADM

로그인조직 및 계약 가격 보기
모든 사진(1)

About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

100

제품 라인

MISSION®

형태

lyophilized powder

esiRNA cDNA 표적 서열

TGGCACACCAGATCTACCAGTTCACAGATAAGGACAAGGACAACGTCGCCCCCAGGAGCAAGATCAGCCCCCAGGGCTACGGCCGCCGGCGCCGGCGCTCCCTGCCCGAGGCCGGCCCGGGTCGGACTCTGGTGTCTTCTAAGCCACAAGCACACGGGGCTCCAGCCCCCCCGAGTGGAAGTGCTCCCCACTTTCTTTAGGATTTAGGCGCCCATGGTACAAGGAATAGTCGCGCAAGCATCCCGCTGGTGCCTCCCGGGACGAAGGACTTCCCGAGCGGTGTGGGGACCGGGCTCTGACAGCCCTGCGGAGACCCTGAGTCCGGGAGGCACCGTCCGGCGGCGAGCTCTGGCTTTGCAAGGGCCCCTCCTTCTGGGGGCTTCGCTTCCTTAGCCTTGCTCAGGTGCAAGTGCCCCAGGGGGCGGGGTGCAGAAGAATCCGAGTGTTTGCCAGGCTTAAGGA

Ensembl | 인체 수납 번호

ENSG00000148926

NCBI 수납 번호

NM_001124

배송 상태

ambient

저장 온도

−20°C

유전자 정보

human ... ADM(133) , ADM(133)

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable

시험 성적서(COA)

제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Lu Yao et al.
Archives of medical research, 50(1), 47-57 (2019-03-21)
Osteosarcoma is one of the most pernicious primary bone tumor characterized by high malignancy and metastasis, however its pathogenesis remain largely unknown. Our previous study showed elevated expression of adrenomedullin (ADM) is correlated with prognosis and disease severity in osteosarcoma
Carole-Anne Whigham et al.
Pregnancy hypertension, 16, 16-25 (2019-05-06)
Preeclampsia is a pregnancy complication associated with elevated placental secretion of anti-angiogenic factors, maternal endothelial dysfunction and end-organ injury. Adrenomedullin (ADM) is a pro-angiogenic peptide hormone which regulates blood pressure and vascular integrity. It is highly expressed in both the
Shaojie Zhang et al.
Biochemical and biophysical research communications, 464(4), 1048-1053 (2015-07-22)
Bronchopulmonary dysplasia (BPD) is a chronic lung disease of premature infants that is characterized by alveolar simplification and decreased lung angiogenesis. Hyperoxia-induced oxidative stress and inflammation contributes to the development of BPD in premature infants. Adrenomedullin (AM) is an endogenous
Tiechui Zhu et al.
Molecular medicine reports, 11(5), 3760-3766 (2015-01-15)
Renal tubular epithelial cells can enter the epithelial‑to‑mesenchymal transition (EMT) in response to chronic hypoxia. EMT is a process which involves the phenotypic conversion of epithelial cells, that is believed to have an important role in renal fibrosis. However, the

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.