콘텐츠로 건너뛰기
Merck
모든 사진(1)

문서

EHU041431

Sigma-Aldrich

MISSION® esiRNA

targeting human AQP4

로그인조직 및 계약 가격 보기
모든 사진(1)

About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

100

제품 라인

MISSION®

형태

lyophilized powder

esiRNA cDNA 표적 서열

GCATGTGATTGACGTTGACCGGGGAGAGGAGAAGAAGGGGAAAGACCAATCTGGAGAGGTATTGTCTTCAGTATGACTAGAAGATCGCACTGAAAGCAGACAAGACTCCTTAGAACTGTCCTCAGATTTCCTTCCACCCATTAAGGAAACAGATTTGTTATAAATTAGAAATGTGCAGGTTTGTTGTTTCATGTCATATTACTCAGTCTAAACAATAAATATTTCATAATTTACAAAGGAGGAACGGAAGAAACCTATTGTGAATTCCAAATCTAAAAAAAGAAATATTTTTAAAATGTTCTTAAGCAAATATATACCTATTTTATCTAGTTACCTTTCATTAACAACCAATTTTAACCGTGTGTCAAGATTTGGTTAAGTCTTGCCTGACAGAACTCAAAGACACG

Ensembl | 인체 수납 번호

ENSG00000171885

NCBI 수납 번호

NM_001650

배송 상태

ambient

저장 온도

−20°C

유전자 정보

human ... AQP4(361) , AQP4(361)

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable

시험 성적서(COA)

제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Letizia Granieri et al.
PloS one, 7(6), e38896-e38896 (2012-06-22)
Neuromyelitis optica (NMO) is a severely disabling autoimmune disorder of the central nervous system, which predominantly affects the optic nerves and spinal cord. In a majority of cases, NMO is associated with antibodies to aquaporin-4 (AQP4) (termed NMO-IgG). In this
Chao Yang et al.
IUBMB life, 67(3), 182-190 (2015-04-11)
Emerging evidence indicates that the water channel protein aquaporin 4 (AQP4) plays an essential role in water homeostasis and is implicated in the pathogenesis of brain edema. This study aimed to understand the physiological role of AQP4 in hypoxia-ischemia-mediated cytotoxic
Yusi Cheng et al.
Clinical and experimental pharmacology & physiology, 44(11), 1106-1115 (2017-07-09)
Aquaporin 4 (AQP4) is a type of water channel protein that maintains the water balance of cardiomyocytes. However, the physiological role of AQP4 in cardiovascular disease is poorly understood. We wanted to explore whether p66Shc and endoplasmic reticulum stress participates
Jing Jin et al.
European neurology, 83(6), 581-590 (2020-11-02)
Stroke is one of the leading causes of mortality and disability worldwide. Long noncoding RNAs (lncRNAs) including MALAT1 have been shown to have critical roles in cerebral ischemia reperfusion injury (CIRI). However, the underlying mechanism of MALAT1 in CIRI has
Dongfeng Niu et al.
PloS one, 7(7), e40770-e40770 (2012-07-19)
Aquaporin3 (AQP3) and Aquaporin4 (AQP4) play a major role in transcellular and transepithelial water movement as water channel membrane proteins. Little is known of their expression and significance in human thyroid tissues. Thus, we examined the expression of AQP3 and

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.