설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
형태
lyophilized powder
esiRNA cDNA 표적 서열
CTAAGCTCAGTGCCCTCCAGCCCAGCCTCACGGCCCAAACTGCCCCTCCACAGCCCCTCGAGCTGGAGCATCCCACCAGAGGGAAGCTGGGGTCCTCTCCCGACAACCCTTCCTCTGCCCTGGGGCTTGCACGTCTGCAGAGCAGGGAGCACAAACCTGCTCTCTCAGCAGCCACTTGGCAAGGGCTGGTTGTGGATCCCAGCCCTCACCCTCTCCTGGCCTTTCCTCTGCTCTCCTCTGCTCAAGTCCACTTCTAACCTGGTCTTCGGAGCTGGGTTGGCCCCTTCTTTGGGCTCAGGAAGCAGCCTTAGCACACGGGCCTCTCCTCCCTCACTACTGGGTGCTGCCCTGCGTGGCTGACCAGCTGGCCCAGGATTTCACAGTCGAAAAGGAAGCCACCACTGATG
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... BATF2(116071) , BATF2(116071)
일반 설명
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
시험 성적서(COA)
제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.
Yinghui Huang et al.
Cancer letters, 373(1), 57-66 (2016-01-26)
Dexamethasone (Dex) has been commonly used in lymphoma and leukemia treatment, but the detailed mechanisms are not fully understood. Suppressor of AP-1 regulated by interferon (SARI) has tumor-selective growth inhibitory effect. However, it's unclear whether SARI is involved in the
Sugata Roy et al.
Journal of immunology (Baltimore, Md. : 1950), 194(12), 6035-6044 (2015-05-10)
Basic leucine zipper transcription factor Batf2 is poorly described, whereas Batf and Batf3 have been shown to play essential roles in dendritic cell, T cell, and B cell development and regulation. Batf2 was drastically induced in IFN-γ-activated classical macrophages (M1)
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.