설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
CCTTCAGCTCTCCATTGCTTTCTATAATCCAGACCTTCAGCATGATGCTAGGAGATATCAATTATCGAGAGTCCTTCCTAGAACCATATCTGAGAAATGAATTGGCACATCCAGTTCTGTCCTTTGCACAACTTGTTTCCTTCACAATATTTGTCCCAATTGTCCTCATGAATTTACTTATTGGTTTGGCAGTTGGCGACATTGCTGAGGTCCAGAAACATGCATCATTGAAGAGGATAGCTATGCAGGTGGAACTTCATACCAGCTTAGAGAAGAAGCTGCCACTTTGGTTTCTACGCAAAGTGGATCAGAAATCCACCATCGTGTATCCCAACAAACCCAGATCTGGTGGGATGTTATTCCATATATTCTGTTTTTTATTTTGCACTGGGGAAATAAGACAAGAAATACCAAATGCTGATAAATCTTTAGAAATGGAAATATTAAAGCAGAAATACCGGCTGA
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... TRPA1(8989) , TRPA1(8989)
일반 설명
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
Effects of non-euphoric plant cannabinoids on muscle quality and performance of dystrophic mdx mice.
Fabio Arturo Iannotti et al.
British journal of pharmacology, 176(10), 1568-1584 (2018-08-04)
Duchenne muscular dystrophy (DMD), caused by dystrophin deficiency, results in chronic inflammation and irreversible skeletal muscle degeneration. Moreover, the associated impairment of autophagy greatly contributes to the aggravation of muscle damage. We explored the possibility of using non-euphoric compounds present
Florentina Cojocaru et al.
Scientific reports, 11(1), 2018-2018 (2021-01-23)
The transient receptor potential ankyrin type 1 (TRPA1) channel belongs to the TRP superfamily of ion channels. TRPA1 is a membrane protein with multiple functions able to respond to noxious stimuli, reactive oxygen species, inflammatory cytokines or pungent substances, and
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.