콘텐츠로 건너뛰기
Merck
모든 사진(1)

Key Documents

EHU039411

Sigma-Aldrich

MISSION® esiRNA

targeting human SAG

로그인조직 및 계약 가격 보기


About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

제품 라인

MISSION®

형태

lyophilized powder

esiRNA cDNA 표적 서열

TTGCGGTCTCTCTCAACAAAGAGATCTATTTCCATGGGGAGCCCATCCCTGTGACCGTGACTGTCACCAATAACACAGAGAAGACCGTGAAGAAGATTAAAGCATTCGTGGAACAGGTGGCCAATGTGGTTCTCTACTCGAGTGATTATTACGTCAAGCCCGTGGCTATGGAGGAAGCGCAAGAAAAAGTGCCACCAAACAGCACTTTGACCAAGACGCTGACGCTGCTGCCCTTGCTGGCTAACAATCGAGAAAGGAGAGGCATTGCCCTGGATGGGAAAATCAAGCACGAGGACACAAACCTTGCCTCCAGCACCATCATTAAGGAGGGCATAGACCGGACCGTCCTGGGAATCCTGGTGTCTTACCAGATCAAGGTGAAGCTCACAGTGTCAGGCTTGGGAGAGA

Ensembl | 인체 수납 번호

배송 상태

ambient

저장 온도

−20°C

유전자 정보

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable


시험 성적서(COA)

제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Zhi-Yu Song et al.
Oncogene, 38(9), 1560-1575 (2018-10-20)
Both chemokine receptors (CXCRs) 7 and 4 can facilitate immune cell migration and mediate a vast array of physiological and pathological events. Herein we report, in both human and animal studies, that these two CXCRs can form heterodimers in vivo
Taehyung Lee et al.
Journal of cellular physiology, 231(5), 992-1000 (2015-10-20)
β-Arrestins are multifunctional scaffolding proteins that modulate G protein-coupled receptor (GPCR)-dependent and -independent cell signaling pathways in various types of cells. We recently demonstrated that β-arrestin1 (β-arr1) deficiency strikingly attenuates dextran sodium sulfate (DSS)-induced colitis in mice. Since DSS-induced colitis
Benedetta Assetta et al.
Cell reports, 27(7), 1960-1966 (2019-05-16)
JC polyomavirus (JCPyV) is a ubiquitous human pathogen that causes progressive multifocal leukoencephalopathy (PML). The entry receptors for JCPyV belong to the 5-hydroxytryptamine 2 receptor (5-HT2R) family, but how individual members of the family function to facilitate infection is not
Colleen L Mayberry et al.
Journal of virology, 93(8) (2019-02-01)
JC polyomavirus (JCPyV) establishes a persistent, lifelong, asymptomatic infection within the kidney of the majority of the human population. Under conditions of severe immunosuppression or immune modulation, JCPyV can reactivate in the central nervous system (CNS) and cause progressive multifocal
S C Chang et al.
Cell death and differentiation, 21(9), 1388-1398 (2014-05-03)
The checkpoint between the life and death of macrophages is crucial for the host's frontline immune defense during acute phase infection. However, the mechanism as to how the immune cell equilibrates between apoptosis and immune response is unclear. Using in

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.