콘텐츠로 건너뛰기
Merck
모든 사진(1)

문서

EHU036651

Sigma-Aldrich

MISSION® esiRNA

targeting human STAT5B

로그인조직 및 계약 가격 보기


About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

제품 라인

MISSION®

형태

lyophilized powder

esiRNA cDNA 표적 서열

TGACGGTGTGATGGAAGTGTTAAAAAAACATCTCAAGCCTCATTGGAATGATGGGGCCATTTTGGGGTTTGTAAACAAGCAACAGGCCCATGACCTACTCATTAACAAGCCAGATGGGACCTTCCTCCTGAGATTCAGTGACTCAGAAATTGGCGGCATCACCATTGCTTGGAAGTTTGATTCTCAGGAAAGAATGTTTTGGAATCTGATGCCTTTTACCACCAGAGACTTCTCCATTCGGTCCCTAGCCGACCGCTTGGGAGACTTGAATTACCTTATCTACGTGTTTCCTGATCGGCCAAAAGATGAAGTATACTCCAAATACTACACACCAGTTCCCTGCGAGTCTGCTACTGCTAAAGCTGTTGATGGATACGTGAAGCCACAGATCAAGCAAGTGGTCCCTGAGT

Ensembl | 인체 수납 번호

NCBI 수납 번호

배송 상태

ambient

저장 온도

−20°C

유전자 정보

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable


시험 성적서(COA)

제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Gabrielle Sueur et al.
Scientific reports, 10(1), 1906-1906 (2020-02-07)
We recently identified the CDC25A phosphatase as a key actor in proliferation and differentiation in acute myeloid leukemia expressing the FLT3-ITD mutation. In this paper we demonstrate that CDC25A level is controlled by a complex STAT5/miR-16 transcription and translation pathway
Dharmalingam Subramaniam et al.
Cell death & disease, 11(2), 149-149 (2020-02-26)
Osteosarcoma (OS) is the most common primary bone tumor that primarily affects children and adolescents. Studies suggested that dysregulation JAK/STAT signaling promotes the development of OS. Cells treated with pimozide, a STAT5 inhibitor suppressed proliferation and colony formation and induced
Sarah Bertoli et al.
Oncotarget, 6(35), 38061-38078 (2015-10-31)
We investigated cell cycle regulation in acute myeloid leukemia cells expressing the FLT3-ITD mutated tyrosine kinase receptor, an underexplored field in this disease. Upon FLT3 inhibition, CDC25A mRNA and protein were rapidly down-regulated, while levels of other cell cycle proteins

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.