콘텐츠로 건너뛰기
Merck
모든 사진(1)

문서

EHU034321

Sigma-Aldrich

MISSION® esiRNA

targeting human CP

로그인조직 및 계약 가격 보기
모든 사진(1)

About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

제품 라인

MISSION®

형태

lyophilized powder

esiRNA cDNA 표적 서열

GAATGGACTGTCCCCAAAGAAGTAGGACCCACTAATGCAGATCCTGTGTGTCTAGCTAAGATGTATTATTCTGCTGTGGAACCCACTAAAGATATATTCACTGGGCTTATTGGGCCAATGAAAATATGCAAGAAAGGAAGTTTACATGCAAATGGGAGACAGAAAGATGTAGACAAGGAATTCTATTTGTTTCCTACAGTATTTGATGAGAATGAGAGTTTACTCCTGGAAGATAATATTAGAATGTTTACAACTGCACCTGATCAGGTGGATAAGGAAGATGAAGACTTTCAGGAATCTAATAAAATGCACTCCATGAATGGATTCATGTATGGGAATCAGCCGGGTCTCACTATGTGCAAAGGAGATTCGGTCGTGTGGTACTTATTCAGCGCCGGAAATGAGGCCGATGTACATGGAATATACTTTTCAGGAAACACATATCTGTGGAGAGGAGAACGGAGAGACACAGC

Ensembl | 인체 수납 번호

ENSG00000047457

NCBI 수납 번호

NM_000096

배송 상태

ambient

저장 온도

−20°C

유전자 정보

human ... CP(1356) , CP(1356)

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable

시험 성적서(COA)

제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Yi Zhang et al.
Experimental cell research, 358(2), 234-241 (2017-07-01)
Neddylation inhibitor Pevonedistat (MLN4924) is a novel anticancer drug and has demonstrated broad-spectrum anticancer activity. Nevertheless, we found that Pevonedistat had only a modest apoptotic effect in osteosarcoma (OS) cells. Moreover, we noted that inhibition of neddylation by Pevonedistat led
Pei-Wen Wang et al.
International journal of molecular sciences, 20(18) (2019-09-25)
Wilson's disease (WD) is an autosomal recessive disorder of copper metabolism caused by defects in the ATPase gene (ATP7B). The various clinical features result from the massive accumulation of copper in the liver, cornea and basal ganglia. Although WD can
H-L Huang et al.
Oncogenesis, 6(7), e359-e359 (2017-07-12)
MUC1-C overexpression has been associated with the progression of pancreatic tumors by promoting the aggressive and metastatic phenotypes. As MUC1 is a STAT3 target gene, STAT3 plays a major role in regulating MUC1-C expression. In this study, we report an
Gang Liu et al.
Cell death & disease, 10(10), 688-688 (2019-09-20)
CELF6, a member of the CELF family of RNA-binding proteins, regulates muscle-specific alternative splicing and contributes to the pathogenesis of myotonic dystrophy (DM), however the role of CELF6 in cancer cell proliferation is less appreciated. Here, we show that the
Seong Hye Park et al.
Oncogene, 39(1), 136-150 (2019-08-30)
Hypoxia, or the deficiency of oxygen, in solid tumors is majorly responsible for the progression of cancer and remains unaffected by chemotherapy, but still requires definitive definition of the hypoxia signaling. Hypoxia disrupts the complete folding of mitochondrial proteins, leading
모든 관련된 서류 보기

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.