콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

EHU034241

Sigma-Aldrich

MISSION® esiRNA

targeting human SLC13A2

로그인조직 및 계약 가격 보기
모든 사진(1)

About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

100

제품 라인

MISSION®

양식

lyophilized powder

esiRNA cDNA 표적 서열

CTTCAGCCTGCACTCTTTCCCCTCCTGGGCACAGTCCAACACCACAGCCCAGTGCCTGCCAAGCCTGGCCAACACCACCACACCAAGCCCCTAGGCTGGGGCACAGCCTGGCCATGCCCAGGAAGACCCACCCCATTCCCACTCCTCTGAGCCCGGAGGGGACACCCCAAGCTCCAAGCTCCAAGCTCCAGGCCAAAGGCTGAAAGGCACGTGTGTACATAATCTCTTGCGTGTCTGTAAGGAAGGGGTGTATGCTCAGTTTCCTATGTGCTGGAATAAAAGGTGTGTGCATGTGTGTGTGCGCATATGTGTGCGCCTGCATGGATGTGAGGGGTGTGTGACGTGAGGCTATCTGAGGGGGGCTGTGTGCATGCACATGATCCTAGGTATGTATGTTGGACAGTGCACACGTGTGTGTTCACAGACAATACAACATGCCCTCTCTGGTGCCCCAGGTCTTGGTATCCCCAGCT

Ensembl | 인체 수납 번호

ENSG00000007216

NCBI 수납 번호

NM_003984

배송 상태

ambient

저장 온도

−20°C

유전자 정보

human ... SLC13A2(9058) , SLC13A2(9058)

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable

가장 최신 버전 중 하나를 선택하세요:

시험 성적서(COA)

Lot/Batch Number
ZAV
QCS

적합한 버전을 찾을 수 없으신가요?

특정 버전이 필요한 경우 로트 번호나 배치 번호로 특정 인증서를 찾을 수 있습니다.

COA 검색

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Neil R Hackett et al.
PloS one, 6(5), e18378-e18378 (2011-05-17)
The human airway epithelium consists of 4 major cell types: ciliated, secretory, columnar and basal cells. During natural turnover and in response to injury, the airway basal cells function as stem/progenitor cells for the other airway cell types. The objective
Lynne Bingle et al.
Histochemistry and cell biology, 138(5), 749-758 (2012-07-07)
Although the biology the PLUNC (recently renamed BPI fold, BPIF) family of secreted proteins is poorly understood, multiple array based studies have suggested that some are differentially expressed in lung diseases. We have examined the expression of BPIFB1 (LPLUNC1), the
Lynne Bingle et al.
Respiratory research, 7, 61-61 (2006-04-08)
The Whey Acidic Protein domain is an evolutionarily conserved motif found in a number of proteins, the best studied of which are antiproteinases involved in the innate immune defence of multiple epithelia. We recently characterised the WFDC2 gene which encodes
Loren Masterson et al.
Journal of skin cancer, 2014, 596459-596459 (2014-03-19)
Due to the rarity of Merkel cell carcinoma (MCC), prospective clinical trials have not been practical. This study aimed to identify biomarkers with prognostic significance. While sixty-two patients were identified who were treated for MCC at our institution, only seventeen
Lynne Bingle et al.
Respiratory research, 8, 79-79 (2007-11-09)
Short PLUNC1 (SPLUNC1) is the founding member of a family of proteins (PLUNCS) expressed in the upper respiratory tract and oral cavity, which may function in host defence. It is one of the most highly expressed genes in the upper

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.