콘텐츠로 건너뛰기
Merck
모든 사진(1)

Key Documents

EHU033021

Sigma-Aldrich

MISSION® esiRNA

targeting human ZNF609

로그인조직 및 계약 가격 보기
모든 사진(1)

About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

제품 라인

MISSION®

형태

lyophilized powder

esiRNA cDNA 표적 서열

AAACCAACAGCCCTGCATACTCTGACATCTCTGATGCTGGGGAGGATGGGGAGGGCAAGGTAGACAGTGTCAAATCAAAGGACGCCGAACAGTTGGTTAAAGAAGGGGCTAAGAAAACTCTTTTTCCCCCTCAGCCTCAGAGCAAAGACTCACCATATTACCAAGGCTTTGAGAGTTACTATTCTCCAAGTTATGCACAGTCCAGCCCTGGGGCTCTGAACCCCAGCAGCCAGGCAGGAGTGGAGAGCCAGGCCCTGAAGACAAAAAGGGATGAGGAACCTGAGAGCATAGAAGGGAAAGTGAAGAACGATATCTGTGAAGAAAAGAAGCCCGAGCTGAGCAGTTCCAGTCAGCAGCCCTCGGTCATCCAGCAGCGTCCCAATATGTACATGCAGTCCCTGTACTACAACCAGTATGCCTATGTACCCCCCTATGGCTACAGCGACCAGAGTTACCACACCCACCTTCTGAGCACT

Ensembl | 인체 수납 번호

ENSG00000180357

NCBI 수납 번호

NM_015042

배송 상태

ambient

저장 온도

−20°C

유전자 정보

human ... ZNF609(23060) , ZNF609(23060)

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable

시험 성적서(COA)

제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Yunhe Xiong et al.
Journal of cellular physiology, 234(7), 10646-10654 (2018-11-28)
Circular RNA (circRNA) play important roles in the pathological processes of many diseases. By analyzing the results of the GSE100186 chip, we found that the expression of circRNA ZNF609 (circ-ZNF609) was significantly increased in renal cell carcinoma. Recently, there are
L Zhu et al.
European review for medical and pharmacological sciences, 23(7), 2817-2826 (2019-04-20)
This study aims to explore the biological function of circular RNA ZNF609 (circ-ZNF609) in regulating the occurrence and progression of nasopharyngeal carcinoma (NPC), and to investigate the possible underlying mechanism. The expression levels of circ-ZNF609, microRNA-150-5p and Sp1 in NPC
Shaoxia Liu et al.
Journal of cellular physiology, 236(1), 79-92 (2021-01-19)
Circular RNAs (circRNAs) have been associated with lung cancer (LC), one of the most common cancers, but the underlying molecular mechanisms of the specific correlation with LC carcinogenesis remain unveiled. Quantitative real-time polymerase chain reaction was applied to examine the

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.