콘텐츠로 건너뛰기
Merck
모든 사진(1)

문서

EHU031671

Sigma-Aldrich

MISSION® esiRNA

targeting human CD81

로그인조직 및 계약 가격 보기
모든 사진(1)

About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

제품 라인

MISSION®

형태

lyophilized powder

esiRNA cDNA 표적 서열

GCTGTCATGATGTTCGTTGGCTTCCTGGGCTGCTACGGGGCCATCCAGGAATCCCAGTGCCTGCTGGGGACGTTCTTCACCTGCCTGGTCATCCTGTTTGCCTGTGAGGTGGCCGCCGGCATCTGGGGCTTTGTCAACAAGGACCAGATCGCCAAGGATGTGAAGCAGTTCTATGACCAGGCCCTACAGCAGGCCGTGGTGGATGATGACGCCAACAACGCCAAGGCTGTGGTGAAGACCTTCCACGAGACGCTTGACTGCTGTGGCTCCAGCACACTGACTGCTTTGACCACCTCAGTGCTCAAGAACAATTTGTGTCCCTCGGGCAGCAACATCATCAGCAACCTCTTCAAGGAGGACTGCCACCAGAAGATCGATGACCTCTTCTCCGGGAAGCTGTACCTCATCGGCAT

Ensembl | 인체 수납 번호

ENSG00000110651

NCBI 수납 번호

NM_004356

배송 상태

ambient

저장 온도

−20°C

유전자 정보

human ... CD81(975) , CD81(975)

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable

시험 성적서(COA)

제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Down-regulation of CD81 in human cells producing HCV-E1/E2 retroVLPs.
Ana F Rodrigues et al.
BMC proceedings, 5 Suppl 8, P72-P72 (2012-03-01)
Zhen-yong Keck et al.
PLoS pathogens, 8(4), e1002653-e1002653 (2012-04-19)
The majority of broadly neutralizing antibodies to hepatitis C virus (HCV) are against conformational epitopes on the E2 glycoprotein. Many of them recognize overlapping epitopes in a cluster, designated as antigenic domain B, that contains residues G530 and D535. To
Raphaël Gaudin et al.
PloS one, 8(7), e69450-e69450 (2013-08-08)
During HIV pathogenesis, infected macrophages behave as "viral reservoirs" that accumulate and retain virions within dedicated internal Virus-Containing Compartments (VCCs). The nature of VCCs remains ill characterized and controversial. Using wild-type HIV-1 and a replication-competent HIV-1 carrying GFP internal to
Chien-Te K Tseng et al.
The Journal of experimental medicine, 195(1), 43-49 (2002-01-10)
Infection with hepatitis C virus (HCV) is a leading cause of chronic liver disease worldwide. Little is known about how this virus is able to persist or whether this persistence might be because of its ability to alter the early
Zhihui Chen et al.
PloS one, 6(4), e18933-e18933 (2011-04-29)
HCV infection is often associated with B-cell regulatory control disturbance and delayed appearance of neutralizing antibodies. CD81 is a cellular receptor for HCV and can bind to HCV envelope protein 2 (E2). CD81 also participates to form a B cell
모든 관련된 서류 보기

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.