콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

EHU027141

Sigma-Aldrich

MISSION® esiRNA

targeting human PTN

로그인조직 및 계약 가격 보기


About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

제품 라인

MISSION®

양식

lyophilized powder

esiRNA cDNA 표적 서열

GAGTGCAAGCAAACCATGAAGACCCAGAGATGTAAGATCCCCTGCAACTGGAAGAAGCAATTTGGCGCGGAGTGCAAATACCAGTTCCAGGCCTGGGGAGAATGTGACCTGAACACAGCCCTGAAGACCAGAACTGGAAGTCTGAAGCGAGCCCTGCACAATGCCGAATGCCAGAAGACTGTCACCATCTCCAAGCCCTGTGGCAAACTGACCAAGCCCAAACCTCAAGCAGAATCTAAGAAGAAGAAAAAGGAAGGCAAGAAACAGGAGAAGATGCTGGATTAAAAGATGTCACCTGTGGAACATAAAAAGGACATCAGCAAACAGGATCAGTTAACTATTGCATTTATATGTACCGTAGGCTTTGTATTCAAAAATTATCTATAGCTAAGTACACAATAAGCAAAAACAAAAAGAAAAGAAAATTTTTGTAGTAGCGTTTTTTAAATGTATACTATAGTACCAGTAGGGGCTTATAATAAAGGA

Ensembl | 인체 수납 번호

NCBI 수납 번호

배송 상태

ambient

저장 온도

−20°C

유전자 정보

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable


가장 최신 버전 중 하나를 선택하세요:

시험 성적서(COA)

Lot/Batch Number

적합한 버전을 찾을 수 없으신가요?

특정 버전이 필요한 경우 로트 번호나 배치 번호로 특정 인증서를 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Biqiang Zhu et al.
Cancer medicine, 9(2), 783-796 (2020-01-21)
Cholangiocarcinoma is a malignant tumor originating from bile duct epithelium. Currently, the treatment strategy is very limited and the prognosis is poor. Recent studies reported celastrol exhibits antigrowth and antimetastasis properties in many tumors. Our study aimed to assess the
Xingxing Sun et al.
Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie, 128, 110201-110201 (2020-05-28)
Opa-interacting protein 5 antisense RNA1 (OIP5-AS1) has been demonstrated to facilitate proliferation, metastasis and resistance to treatments in various types of cancers. Nevertheless, the exact mechanisms underlying the roles of OIP5-AS1 in osteosarcoma(OS) drug resistance have not yet been clearly
Xue Ding et al.
Graefe's archive for clinical and experimental ophthalmology = Albrecht von Graefes Archiv fur klinische und experimentelle Ophthalmologie, 255(5), 873-884 (2017-01-14)
The purpose of our study was to investigate the effects of pleiotrophin (PTN) in proliferative vitreoretinopathy (PVR) both in vitro and in vivo. Immunofluorescence was used to observe the PTN expression in periretinal membrane samples from patients with PVR and

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.