콘텐츠로 건너뛰기
Merck
모든 사진(1)

문서

EHU026851

Sigma-Aldrich

MISSION® esiRNA

targeting human TBC1D9

로그인조직 및 계약 가격 보기
모든 사진(1)

About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

제품 라인

MISSION®

형태

lyophilized powder

esiRNA cDNA 표적 서열

CTGGTGGACCAAGGTGTCTTTGAGGAGCTAGCACGAGACTACGTCCCACAGCTGTACGACTGCATGCAAGACCTGGGCGTGATTTCCACCATCTCCCTGTCTTGGTTCCTCACACTATTTCTCAGTGTGATGCCTTTTGAGAGTGCAGTTGTGGTTGTTGACTGTTTCTTCTATGAAGGAATTAAAGTGATATTCCAGTTGGCCCTAGCTGTGCTGGATGCAAATGTGGACAAACTGTTGAACTGCAAGGATGATGGGGAGGCCATGACCGTTTTGGGAAGGTATTTAGACAGTGTGACCAATAAAGACAGCACACTGCCTCCCATTCCTCACCTCCACTCCTTGCTCAGCGATGATGTGGAACCTTACCCTGAGGTAGACATCTTTAGACTCATCAGAACTTCCTACGAGAAATTCGGAACTATCCGGGCAGATTTGATTGAACAGATGAGATTCAAACAGAGACTGAAAGTGATCCAGACGCTG

Ensembl | 인체 수납 번호

ENSG00000109436

배송 상태

ambient

저장 온도

−20°C

유전자 정보

human ... TBC1D9(23158) , TBC1D9(23158)

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable

시험 성적서(COA)

제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Xiaoqian Yang et al.
Pharmaceutical research, 32(6), 2097-2109 (2014-12-18)
Approaches for the synthesis of biomaterials to facilitate the delivery of "biologics" is a major area of research in cancer therapy. Here we designed and characterized a hyaluronic acid (HA) based self-assembling nanoparticles that can target CD44 receptors overexpressed on
Tao Wang et al.
Theranostics, 5(12), 1456-1472 (2015-12-19)
Understanding the molecular basis of drug resistance and utilising this information to overcome chemoresistance remains a key challenge in oncology. Here we report that survivin, a key protein implicated in drug resistance, is overexpressed in cancer stem cell pool of
Takashi Nozawa et al.
Nature communications, 11(1), 770-770 (2020-02-09)
Invading microbial pathogens can be eliminated selectively by xenophagy. Ubiquitin-mediated autophagy receptors are phosphorylated by TANK-binding kinase 1 (TBK1) and recruited to ubiquitinated bacteria to facilitate autophagosome formation during xenophagy, but the molecular mechanism underlying TBK1 activation in response to
Runbi Ji et al.
Cell cycle (Georgetown, Tex.), 14(15), 2473-2483 (2015-06-20)
Mesenchymal stem cells (MSCs) play an important role in chemoresistance. Exosomes have been reported to modify cellular phenotype and function by mediating cell-cell communication. In this study, we aimed to investigate whether exosomes derived from MSCs (MSC-exosomes) are involved in
Xia Wen et al.
Toxicological sciences : an official journal of the Society of Toxicology, 141(2), 475-483 (2014-07-13)
Paraquat is a herbicide that is highly toxic to the lungs and kidneys following acute exposures. Prior studies have demonstrated that the organic cation transporter 2 and multidrug and toxin extrusion protein 1 contribute to the urinary secretion of paraquat
모든 관련된 서류 보기

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.