콘텐츠로 건너뛰기
Merck
모든 사진(1)

Key Documents

EHU026451

Sigma-Aldrich

MISSION® esiRNA

targeting human ORMDL3

로그인조직 및 계약 가격 보기


About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

제품 라인

MISSION®

형태

lyophilized powder

esiRNA cDNA 표적 서열

GTGGCATCTGGCTCTCCTACGTGCTGGCCATCGGTCTCCTCCACATCGTGCTGCTGAGCATCCCGTTTGTGAGTGTCCCTGTCGTCTGGACCCTCACCAACCTCATTCACAACATGGGCATGTATATCTTCCTGCACACGGTGAAGGGGACACCCTTTGAGACCCCGGACCAGGGCAAGGCGAGGCTGCTAACCCACTGGGAGCAGATGGATTATGGGGTCCAGTTCACGGCCTCTCGGAAGTTCTTGACCATCACACCCATCGTGCTGTACTTCCTCACCAGCTTCTACACTAAGTACGACCAGATCCATTTTGTGCTCAACACCGTGTCCCTGATGAGCGTGCTTATCCCCAAGCTGCCCCAGCTCCACGGAGTCCGGATTTTTGGAATCAATAAGTACTGAGAGTGCAGCCCCTT

Ensembl | 인체 수납 번호

NCBI 수납 번호

배송 상태

ambient

저장 온도

−20°C

유전자 정보

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable


시험 성적서(COA)

제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Weixia Yang et al.
Aging, 11(9), 2787-2796 (2019-05-08)
Endoplasmic reticulum (ER) stress in beta cells induces a signaling network called the unfolded protein response (UPR), which plays a dual role in diabetes. A key regulator of ER-stress and UPR, the orosomucoid 1-like protein 3 (ORMDL3), has been shown
Youming Zhang et al.
American journal of respiratory and critical care medicine, 199(4), 478-488 (2018-10-20)
Polymorphisms on chromosome 17q21 confer the major genetic susceptibility to childhood-onset asthma. Risk alleles positively correlate with ORMDL3 (orosomucoid-like 3) expression. The locus influences disease severity and the frequency of human rhinovirus (HRV)-initiated exacerbations. ORMDL3 is known to regulate sphingolipid
Yiping Liu et al.
American journal of respiratory cell and molecular biology, 62(6), 783-792 (2020-02-23)
Polymorphism at the 17q21 gene locus and wheezing responses to rhinovirus (RV) early in childhood conspire to increase the risk of developing asthma. However, the mechanisms mediating this gene-environment interaction remain unclear. In this study, we investigated the impact of

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.