콘텐츠로 건너뛰기
Merck
모든 사진(1)

Key Documents

EHU025551

Sigma-Aldrich

MISSION® esiRNA

targeting human SLC9A1

로그인조직 및 계약 가격 보기
모든 사진(1)

About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

100

제품 라인

MISSION®

형태

lyophilized powder

esiRNA cDNA 표적 서열

CACCACTGGAACTGGACCTTCGTCATCAGCACCCTGCTCTTCTGCCTCATCGCCCGCGTGCTGGGGGTGCTGGGCCTGACCTGGTTCATCAACAAGTTCCGTATCGTGAAGCTGACCCCCAAGGACCAGTTCATCATCGCCTATGGGGGCCTGCGAGGGGCCATCGCCTTCTCTCTGGGCTACCTCCTGGACAAGAAGCACTTCCCCATGTGTGACCTGTTCCTCACTGCCATCATCACTGTCATCTTCTTCACCGTCTTTGTGCAGGGCATGACCATTCGGCCCCTGGTAGACCTGTTGGCTGTGAAGAAAAAGCAAGAGACGAAGCGCTCCATCAACGAAGAGATCCACACACAGTTCCTGGACCACCTTCTGACAGGCATCGAAGACATCTGTGGCCACTACGGTCACCACCACTG

Ensembl | 인체 수납 번호

ENSG00000090020

NCBI 수납 번호

NM_003047

배송 상태

ambient

저장 온도

−20°C

유전자 정보

human ... SLC9A1(6548) , SLC9A1(6548)

관련 카테고리

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable

시험 성적서(COA)

제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Yosuke Ariyoshi et al.
Oncotarget, 8(2), 2209-2223 (2016-12-03)
Na+/H+ exchanger 1 (NHE1) is a plasma membrane transporter that controls intracellular pH and regulates apoptosis and invasion in various cancer cells. However, the function of NHE1 in esophageal squamous cell carcinoma (ESCC) cells and the relationship between the expression
A K Pedersen et al.
BMC cancer, 17(1), 542-542 (2017-08-16)
Chronic angiogenesis is a hallmark of most tumors and takes place in a hostile tumor microenvironment (TME) characterized by hypoxia, low nutrient and glucose levels, elevated lactate and low pH. Despite this, most studies addressing angiogenic signaling use hypoxia as
Yogesh Singh et al.
The Journal of biological chemistry, 291(45), 23662-23671 (2016-09-16)
CD4
Zhenni Sun et al.
OncoTargets and therapy, 13, 8521-8532 (2020-09-10)
Several recent studies have addressed the role of Na+/H+ exchanger isoform 1 (NHE1) in tumor cell growth and apoptosis, including in gastric cancer. However, the role of NHE1 expression related to the 5-Fu resistance in gastric cancer has not been
Raj R Malinda et al.
Frontiers in oncology, 10, 687-687 (2020-05-28)
Pancreatic ductal adenocarcinoma (PDAC) is a major cause of cancer-related death, with a 5-year survival of <10% and severely limited treatment options. PDAC hallmarks include profound metabolic acid production and aggressive local proliferation and invasiveness. This phenotype is supported by
모든 관련된 서류 보기

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.