콘텐츠로 건너뛰기
Merck
모든 사진(1)

Key Documents

EHU025411

Sigma-Aldrich

MISSION® esiRNA

targeting human CDH13

로그인조직 및 계약 가격 보기
모든 사진(1)

About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

제품 라인

MISSION®

형태

lyophilized powder

esiRNA cDNA 표적 서열

AAGGGAAACGACAAGCTACGCTATGAGGTCTCGAGCCCATACTTCAAGGTGAACAGCGATGGCGGCTTAGTTGCTCTGAGAAACATAACTGCAGTGGGCAAAACTCTGTTCGTCCATGCACGGACCCCCCATGCGGAAGATATGGCAGAACTCGTGATTGTCGGGGGGAAAGACATCCAGGGCTCCTTGCAGGATATATTTAAATTTGCAAGAACTTCTCCTGTCCCAAGACAAAAGAGGTCCATTGTGGTATCTCCCATTTTAATTCCAGAGAATCAGAGACAGCCTTTCCCAAGAGATGTTGGCAAGGTAGTCGATAGTGACAGGCCAGAAAGGTCCAAGTTCCGGCTCACTGGAAAGGGAGTGGATCAAGAGCCTAAAGGAATTTTCAGAATCAATGAGAACACAGGGAGCGTCTC

Ensembl | 인체 수납 번호

ENSG00000140945

배송 상태

ambient

저장 온도

−20°C

유전자 정보

human ... CDH13(1012) , CDH13(1012)

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable

시험 성적서(COA)

제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Yuya Fujishima et al.
FASEB journal : official publication of the Federation of American Societies for Experimental Biology, 31(4), 1571-1583 (2017-01-08)
Adiponectin, an adipocyte-derived protein abundant in the circulation, is thought to be protective against atherosclerosis. However, it is not fully understood how the association of adiponectin with vascular cells and its antiatherogenic effect are connected. In this study, T-cadherin was
Yuri Tsugawa-Shimizu et al.
American journal of physiology. Endocrinology and metabolism, 320(2), E179-E190 (2020-12-08)
Adiponectin (APN) is a circulating protein specifically produced by adipocytes. Native APN specifically binds to T-cadherin, a glycosylphosphatidylinositol-anchored protein, mediating the exosome-stimulating effects of APN in endothelial, muscle, and mesenchymal stem cells. It was previously reported that APN has beneficial
Keisuke Matsuda et al.
Endocrinology, 156(3), 934-946 (2014-12-17)
Adiponectin (Adipo), a multimeric adipocyte-secreted protein abundant in the circulation, is implicated in cardiovascular protective functions. Recent work documented that Adipo locally associates with responsive tissues through interactions with T-cadherin (Tcad), an atypical, glycosylphosphatidylinositol (GPI)-anchored cadherin cell surface glycoprotein. Mice
Yuki Fujita et al.
Cell reports, 31(4), 107580-107580 (2020-04-30)
Microglia, the resident immune cells of the central nervous system, accumulate along subcerebral projection axons and support neuronal survival during the early postnatal period. It remains unknown how microglia follow an axon-specific distribution pattern to maintain neural circuits. Here, we

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.