콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

EHU024901

Sigma-Aldrich

MISSION® esiRNA

targeting human CCNB1

로그인조직 및 계약 가격 보기


About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

제품 라인

MISSION®

양식

lyophilized powder

esiRNA cDNA 표적 서열

TTGGTGTCACTGCCATGTTTATTGCAAGCAAATATGAAGAAATGTACCCTCCAGAAATTGGTGACTTTGCTTTTGTGACTGACAACACTTATACTAAGCACCAAATCAGACAGATGGAAATGAAGATTCTAAGAGCTTTAAACTTTGGTCTGGGTCGGCCTCTACCTTTGCACTTCCTTCGGAGAGCATCTAAGATTGGAGAGGTTGATGTCGAGCAACATACTTTGGCCAAATACCTGATGGAACTAACTATGTTGGACTATGACATGGTGCACTTTCCTCCTTCTCAAATTGCAGCAGGAGCTTTTTGCTTAGCACTGAAAATTCTGGATAATGGTGAATGGACACCAACTCTACAACATTACCTGTCATATACTGAAGAATCTCTTCTTCCAGTTATGCAGCACCTGGCTAAGAATGTAGTCATGGTAAATCAAGGACTTACAAAGCACATGACTGTCAAGAACAAGTATGCCACATCGAAGCATG

Ensembl | 인체 수납 번호

NCBI 수납 번호

배송 상태

ambient

저장 온도

−20°C

유전자 정보

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable


가장 최신 버전 중 하나를 선택하세요:

시험 성적서(COA)

Lot/Batch Number

적합한 버전을 찾을 수 없으신가요?

특정 버전이 필요한 경우 로트 번호나 배치 번호로 특정 인증서를 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Jinglan Jin et al.
Frontiers in bioengineering and biotechnology, 8, 54-54 (2020-03-07)
Hepatocellular carcinoma (HCC) is one of the important types of liver cancer. LncRNA is an important regulatory factor that regulates many biological processes such as tumor cells during tumorigenesis and metastasis. LINC00346 has been associated with various types of liver
Min Li et al.
World journal of gastroenterology, 27(10), 939-958 (2021-03-30)
Hepatocellular carcinoma (HCC) is one of the most prevalent cancers in human populations worldwide. Huanglian decoction is one of the most important Chinese medicine formulas, with the potential to treat cancer. To investigate the role and mechanism of Huanglian decoction
Daniel Hayward et al.
The Journal of cell biology, 218(4), 1182-1199 (2019-01-25)
Spindle checkpoint signaling is initiated by recruitment of the kinase MPS1 to unattached kinetochores during mitosis. We show that CDK1-CCNB1 and a counteracting phosphatase PP2A-B55 regulate the engagement of human MPS1 with unattached kinetochores by controlling the phosphorylation status of

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.